EMAIL THIS PAGE TO A FRIEND

SPPL2C

signal peptide peptidase like 2C

Synonyms: IMP5
UniProtKB ID: Q8IUH8, Q8TC67, Q8WVZ6
Gene ID:
Mouse(237958) signal peptide peptidase 2C
Rat(287753) signal peptide peptidase like 2C
domestic cat(101081094) signal peptide peptidase like 2C
dog(490923) signal peptide peptidase like 2C
domestic guinea pig(100730262) signal peptide peptidase like 2C
naked mole-rat(101721244) signal peptide peptidase like 2C
cow(513917) signal peptide peptidase like 2C
sheep(101120762) signal peptide peptidase like 2C
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2104928 Anti-IMP5 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175882 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175882 Rosetta Predictions human pricing
NM_001105847 Rosetta Predictions rat pricing
NM_001082535 Rosetta Predictions mouse pricing
NM_199019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114182 predicted 1748
2 SASI_Hs01_00114183 predicted 821
3 SASI_Hs01_00114184 predicted 1489
4 SASI_Hs01_00114185 predicted 1460
5 SASI_Hs01_00114186 predicted 1278
6 SASI_Hs01_00114187 predicted 537
7 SASI_Hs01_00114188 predicted 1565
8 SASI_Hs01_00114189 predicted 804
9 SASI_Hs01_00114190 predicted 364
10 SASI_Hs01_00114191 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213112 predicted 559
2 SASI_Rn02_00213113 predicted 424
3 SASI_Rn02_00213114 predicted 1752
4 SASI_Rn02_00213115 predicted 725
5 SASI_Rn02_00213116 predicted 855
6 SASI_Rn02_00213117 predicted 667
7 SASI_Rn02_00213118 predicted 1714
8 SASI_Rn02_00213119 predicted 1564
9 SASI_Rn02_00213120 predicted 598
10 SASI_Rn02_00213121 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299302 predicted 556
2 SASI_Mm02_00299303 predicted 539
3 SASI_Mm02_00299304 predicted 905
4 SASI_Mm02_00299305 predicted 607
5 SASI_Mm02_00299306 predicted 1262
6 SASI_Mm02_00299307 predicted 1537
7 SASI_Mm02_00299308 predicted 607
8 SASI_Mm02_00299309 predicted 1183
9 SASI_Mm02_00299310 predicted 796
10 SASI_Mm02_00299311 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127629 predicted 554
2 SASI_Mm01_00127630 predicted 537
3 SASI_Mm01_00127631 predicted 907
4 SASI_Mm01_00127632 predicted 608
5 SASI_Mm01_00127634 predicted 1263
6 SASI_Mm01_00127635 predicted 1538
7 SASI_Mm01_00127636 predicted 602
8 SASI_Mm01_00127637 predicted 1186
9 SASI_Mm01_00127638 predicted 797
10 SASI_Mm02_00351276 predicted 748
11 SASI_Mm01_00127633 predicted 451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175882
SPPL2C MISSION shRNA Bacterial Glycerol Stock
signal peptide peptidase like 2C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-1366s1c1
Sequence:CCGGGTTGCTTACTGTTGCCGCTTTCTCGAGAAAGCGGCAACAGTAAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-825s1c1
Sequence:CCGGCCACTTTGTCTATGTCACCATCTCGAGATGGTGACATAGACAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-540s1c1
Sequence:CCGGGCCCATCATCGACTACAACATCTCGAGATGTTGTAGTCGATGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-826s1c1
Sequence:CCGGCACTTTGTCTATGTCACCATTCTCGAGAATGGTGACATAGACAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175882.2-1833s21c1
Sequence:CCGGGACGCCCACTTGGATCCTAATCTCGAGATTAGGATCCAAGTGGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-1358s1c2
Sequence:CCGGGCTTCCTGGTTGCTTACTGTTCTCGAGAACAGTAAGCAACCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175882.2-1757s21c1
Sequence:CCGGCACTGAGATTGTCACCATATCCTCGAGGATATGGTGACAATCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175882.2-730s21c1
Sequence:CCGGGAGCCCAGAAGGAAGATAATGCTCGAGCATTATCTTCCTTCTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175882
SPPL2C MISSION shRNA shRNA Plasmid DNA
signal peptide peptidase like 2C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-1366s1c1
Sequence:CCGGGTTGCTTACTGTTGCCGCTTTCTCGAGAAAGCGGCAACAGTAAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-825s1c1
Sequence:CCGGCCACTTTGTCTATGTCACCATCTCGAGATGGTGACATAGACAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-540s1c1
Sequence:CCGGGCCCATCATCGACTACAACATCTCGAGATGTTGTAGTCGATGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-826s1c1
Sequence:CCGGCACTTTGTCTATGTCACCATTCTCGAGAATGGTGACATAGACAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175882.2-1833s21c1
Sequence:CCGGGACGCCCACTTGGATCCTAATCTCGAGATTAGGATCCAAGTGGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-1358s1c2
Sequence:CCGGGCTTCCTGGTTGCTTACTGTTCTCGAGAACAGTAAGCAACCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175882.2-1757s21c1
Sequence:CCGGCACTGAGATTGTCACCATATCCTCGAGGATATGGTGACAATCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175882.2-730s21c1
Sequence:CCGGGAGCCCAGAAGGAAGATAATGCTCGAGCATTATCTTCCTTCTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175882
SPPL2C MISSION shRNA Lentiviral Transduction Particles
signal peptide peptidase like 2C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-1366s1c1
Sequence:CCGGGTTGCTTACTGTTGCCGCTTTCTCGAGAAAGCGGCAACAGTAAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-825s1c1
Sequence:CCGGCCACTTTGTCTATGTCACCATCTCGAGATGGTGACATAGACAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-540s1c1
Sequence:CCGGGCCCATCATCGACTACAACATCTCGAGATGTTGTAGTCGATGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-826s1c1
Sequence:CCGGCACTTTGTCTATGTCACCATTCTCGAGAATGGTGACATAGACAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175882.2-1833s21c1
Sequence:CCGGGACGCCCACTTGGATCCTAATCTCGAGATTAGGATCCAAGTGGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175882.1-1358s1c2
Sequence:CCGGGCTTCCTGGTTGCTTACTGTTCTCGAGAACAGTAAGCAACCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175882.2-1757s21c1
Sequence:CCGGCACTGAGATTGTCACCATATCCTCGAGGATATGGTGACAATCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175882.2-730s21c1
Sequence:CCGGGAGCCCAGAAGGAAGATAATGCTCGAGCATTATCTTCCTTCTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199019
SPPL2C MISSION shRNA Bacterial Glycerol Stock
signal peptide peptidase like 2C
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199019.1-2067s1c1
Sequence:CCGGGCACAAGAGAAAGGGCTTGAACTCGAGTTCAAGCCCTTTCTCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199019.1-1267s1c1
Sequence:CCGGCCAAGACTGGTGAGAGCATTACTCGAGTAATGCTCTCACCAGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199019.1-1459s1c1
Sequence:CCGGGCTTCGACATGCAAGTCCAATCTCGAGATTGGACTTGCATGTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199019.1-155s1c1
Sequence:CCGGCGTGTCAAAGAACTGGAGCAACTCGAGTTGCTCCAGTTCTTTGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199019.1-605s1c1
Sequence:CCGGCGAGCCTGTTACTGACTATAACTCGAGTTATAGTCAGTAACAGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199019.2-1086s21c1
Sequence:CCGGTCTGGGTCATCCACCGAAATGCTCGAGCATTTCGGTGGATGACCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199019.2-2023s21c1
Sequence:CCGGTCAATCTCGGGTCCATGATAGCTCGAGCTATCATGGACCCGAGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199019
SPPL2C MISSION shRNA shRNA Plasmid DNA
signal peptide peptidase like 2C
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199019.1-2067s1c1
Sequence:CCGGGCACAAGAGAAAGGGCTTGAACTCGAGTTCAAGCCCTTTCTCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199019.1-1267s1c1
Sequence:CCGGCCAAGACTGGTGAGAGCATTACTCGAGTAATGCTCTCACCAGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199019.1-1459s1c1
Sequence:CCGGGCTTCGACATGCAAGTCCAATCTCGAGATTGGACTTGCATGTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199019.1-155s1c1
Sequence:CCGGCGTGTCAAAGAACTGGAGCAACTCGAGTTGCTCCAGTTCTTTGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199019.1-605s1c1
Sequence:CCGGCGAGCCTGTTACTGACTATAACTCGAGTTATAGTCAGTAACAGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199019.2-1086s21c1
Sequence:CCGGTCTGGGTCATCCACCGAAATGCTCGAGCATTTCGGTGGATGACCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199019.2-2023s21c1
Sequence:CCGGTCAATCTCGGGTCCATGATAGCTCGAGCTATCATGGACCCGAGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199019
SPPL2C MISSION shRNA Lentiviral Transduction Particles
signal peptide peptidase like 2C
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199019.1-2067s1c1
Sequence:CCGGGCACAAGAGAAAGGGCTTGAACTCGAGTTCAAGCCCTTTCTCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199019.1-1267s1c1
Sequence:CCGGCCAAGACTGGTGAGAGCATTACTCGAGTAATGCTCTCACCAGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199019.1-1459s1c1
Sequence:CCGGGCTTCGACATGCAAGTCCAATCTCGAGATTGGACTTGCATGTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199019.1-155s1c1
Sequence:CCGGCGTGTCAAAGAACTGGAGCAACTCGAGTTGCTCCAGTTCTTTGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199019.1-605s1c1
Sequence:CCGGCGAGCCTGTTACTGACTATAACTCGAGTTATAGTCAGTAACAGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199019.2-1086s21c1
Sequence:CCGGTCTGGGTCATCCACCGAAATGCTCGAGCATTTCGGTGGATGACCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199019.2-2023s21c1
Sequence:CCGGTCAATCTCGGGTCCATGATAGCTCGAGCTATCATGGACCCGAGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks