EMAIL THIS PAGE TO A FRIEND

SPPL3

signal peptide peptidase like 3

Synonyms: IMP2 MDHV1887 PRO4332 PSH1 PSL4
UniProtKB ID: Q8TCT6, Q3MJ04, Q8TAU4, Q96DD9
Gene ID:
Mouse(74585) signal peptide peptidase 3
Rat(360822) signal peptide peptidase like 3
cow(535156) signal peptide peptidase like 3
sheep(101120111) signal peptide peptidase like 3
naked mole-rat(101721794) signal peptide peptidase like 3
domestic guinea pig(100733832) signal peptide peptidase like 3
Thale Cress(818909) signal peptide peptidase-like 3
Zebrafish(548609) signal peptide peptidase 3
chicken(416968) signal peptide peptidase like 3
domestic cat(101097923) signal peptide peptidase like 3
dog(486301) signal peptide peptidase like 3
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139015 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139015 Rosetta Predictions human pricing
XM_001080325 Rosetta Predictions rat pricing
XM_341096 Rosetta Predictions rat pricing
NM_029012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193922 predicted 1505
2 SASI_Hs01_00193923 predicted 1288
3 SASI_Hs01_00193924 predicted 1688
4 SASI_Hs01_00193925 predicted 1520
5 SASI_Hs01_00193926 predicted 1096
6 SASI_Hs01_00193927 predicted 925
7 SASI_Hs01_00193928 predicted 1501
8 SASI_Hs01_00193930 predicted 745
9 SASI_Hs01_00193931 predicted 1673
10 SASI_Hs02_00364058 predicted 790
11 SASI_Hs01_00193929 predicted 1720
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367588 predicted 234
2 SASI_Rn02_00367589 predicted 364
3 SASI_Rn02_00367590 predicted 601
4 SASI_Rn02_00367591 predicted 251
5 SASI_Rn02_00367592 predicted 331
6 SASI_Rn02_00367593 predicted 247
7 SASI_Rn02_00367594 predicted 429
8 SASI_Rn02_00367595 predicted 824
9 SASI_Rn02_00367596 predicted 1058
10 SASI_Rn02_00367597 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392341 predicted 248
2 SASI_Rn02_00392342 predicted 533
3 SASI_Rn02_00392343 predicted 256
4 SASI_Rn02_00392344 predicted 773
5 SASI_Rn02_00392345 predicted 206
6 SASI_Rn02_00392346 predicted 208
7 SASI_Rn02_00392347 predicted 501
8 SASI_Rn02_00392348 predicted 604
9 SASI_Rn02_00392349 predicted 229
10 SASI_Rn02_00392350 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134850 predicted 690
2 SASI_Mm01_00134851 predicted 919
3 SASI_Mm01_00134852 predicted 966
4 SASI_Mm01_00134853 predicted 906
5 SASI_Mm01_00134854 predicted 1108
6 SASI_Mm01_00134855 predicted 1135
7 SASI_Mm01_00134856 predicted 374
8 SASI_Mm01_00134857 predicted 261
9 SASI_Mm01_00134858 predicted 919
10 SASI_Mm02_00334753 predicted 335
11 SASI_Mm01_00134859 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029012
VALIDATED
SPPL3 MISSION shRNA Bacterial Glycerol Stock
signal peptide peptidase like 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029012.2-1097s21c1
Sequence:CCGGTCCTCTACTTGGTGCCATTTACTCGAGTAAATGGCACCAAGTAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029012.2-919s21c1
Sequence:CCGGCGCTATGACAACTACAAGAAACTCGAGTTTCTTGTAGTTGTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029012.2-691s21c1
Sequence:CCGGGCCTACATCTTCAACAGTAATCTCGAGATTACTGTTGAAGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029012.2-1895s21c1
Sequence:CCGGGCACATAGATATCTGTGAGTACTCGAGTACTCACAGATATCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029012.2-1895s1c1
Sequence:CCGGGCACATAGATATCTGTGAGTACTCGAGTACTCACAGATATCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029012.2-919s1c1
Sequence:CCGGCGCTATGACAACTACAAGAAACTCGAGTTTCTTGTAGTTGTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029012.2-691s1c1
Sequence:CCGGGCCTACATCTTCAACAGTAATCTCGAGATTACTGTTGAAGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029012.2-1096s1c1
Sequence:CCGGCTCCTCTACTTGGTGCCATTTCTCGAGAAATGGCACCAAGTAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029012.2-1097s1c1
Sequence:CCGGTCCTCTACTTGGTGCCATTTACTCGAGTAAATGGCACCAAGTAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029012
VALIDATED
SPPL3 MISSION shRNA shRNA Plasmid DNA
signal peptide peptidase like 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029012.2-1097s21c1
Sequence:CCGGTCCTCTACTTGGTGCCATTTACTCGAGTAAATGGCACCAAGTAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029012.2-919s21c1
Sequence:CCGGCGCTATGACAACTACAAGAAACTCGAGTTTCTTGTAGTTGTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029012.2-691s21c1
Sequence:CCGGGCCTACATCTTCAACAGTAATCTCGAGATTACTGTTGAAGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029012.2-1895s21c1
Sequence:CCGGGCACATAGATATCTGTGAGTACTCGAGTACTCACAGATATCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029012.2-1895s1c1
Sequence:CCGGGCACATAGATATCTGTGAGTACTCGAGTACTCACAGATATCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029012.2-919s1c1
Sequence:CCGGCGCTATGACAACTACAAGAAACTCGAGTTTCTTGTAGTTGTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029012.2-691s1c1
Sequence:CCGGGCCTACATCTTCAACAGTAATCTCGAGATTACTGTTGAAGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029012.2-1096s1c1
Sequence:CCGGCTCCTCTACTTGGTGCCATTTCTCGAGAAATGGCACCAAGTAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029012.2-1097s1c1
Sequence:CCGGTCCTCTACTTGGTGCCATTTACTCGAGTAAATGGCACCAAGTAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029012
VALIDATED
SPPL3 MISSION shRNA Lentiviral Transduction Particles
signal peptide peptidase like 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029012.2-1097s21c1
Sequence:CCGGTCCTCTACTTGGTGCCATTTACTCGAGTAAATGGCACCAAGTAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029012.2-919s21c1
Sequence:CCGGCGCTATGACAACTACAAGAAACTCGAGTTTCTTGTAGTTGTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029012.2-691s21c1
Sequence:CCGGGCCTACATCTTCAACAGTAATCTCGAGATTACTGTTGAAGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029012.2-1895s21c1
Sequence:CCGGGCACATAGATATCTGTGAGTACTCGAGTACTCACAGATATCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029012.2-1895s1c1
Sequence:CCGGGCACATAGATATCTGTGAGTACTCGAGTACTCACAGATATCTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029012.2-919s1c1
Sequence:CCGGCGCTATGACAACTACAAGAAACTCGAGTTTCTTGTAGTTGTCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029012.2-691s1c1
Sequence:CCGGGCCTACATCTTCAACAGTAATCTCGAGATTACTGTTGAAGATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029012.2-1096s1c1
Sequence:CCGGCTCCTCTACTTGGTGCCATTTCTCGAGAAATGGCACCAAGTAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029012.2-1097s1c1
Sequence:CCGGTCCTCTACTTGGTGCCATTTACTCGAGTAAATGGCACCAAGTAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139015
VALIDATED
SPPL3 MISSION shRNA Bacterial Glycerol Stock
signal peptide peptidase like 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_139015.3-1304s21c1
Sequence:CCGGCCTGGTCTCCTACTATGCTTTCTCGAGAAAGCATAGTAGGAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_139015.3-2105s21c1
Sequence:CCGGGAAGCTCTTCTGTCGTTATATCTCGAGATATAACGACAGAAGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139015.3-1541s21c1
Sequence:CCGGCTCCTCACGATGGCCTATTTACTCGAGTAAATAGGCCATCGTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_139015.3-572s21c1
Sequence:CCGGGGTAGTTTCAGGTCCCTTAATCTCGAGATTAAGGGACCTGAAACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_139015.3-1282s21c1
Sequence:CCGGGGGCATCGGAGACATCGTTATCTCGAGATAACGATGTCTCCGATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139015.3-2477s1c1
Sequence:CCGGCCGCAGTTACAAACTAGTATACTCGAGTATACTAGTTTGTAACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_139015.3-1304s1c1
Sequence:CCGGCCTGGTCTCCTACTATGCTTTCTCGAGAAAGCATAGTAGGAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139015.3-659s1c1
Sequence:CCGGAGCACCAATAATAGCATCCAACTCGAGTTGGATGCTATTATTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139015.3-660s1c1
Sequence:CCGGGCACCAATAATAGCATCCAAACTCGAGTTTGGATGCTATTATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_139015.3-1506s1c1
Sequence:CCGGCCCTTCTCTATTTGGTGCCATCTCGAGATGGCACCAAATAGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139015
VALIDATED
SPPL3 MISSION shRNA shRNA Plasmid DNA
signal peptide peptidase like 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_139015.3-1304s21c1
Sequence:CCGGCCTGGTCTCCTACTATGCTTTCTCGAGAAAGCATAGTAGGAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_139015.3-2105s21c1
Sequence:CCGGGAAGCTCTTCTGTCGTTATATCTCGAGATATAACGACAGAAGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139015.3-1541s21c1
Sequence:CCGGCTCCTCACGATGGCCTATTTACTCGAGTAAATAGGCCATCGTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_139015.3-572s21c1
Sequence:CCGGGGTAGTTTCAGGTCCCTTAATCTCGAGATTAAGGGACCTGAAACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_139015.3-1282s21c1
Sequence:CCGGGGGCATCGGAGACATCGTTATCTCGAGATAACGATGTCTCCGATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139015.3-2477s1c1
Sequence:CCGGCCGCAGTTACAAACTAGTATACTCGAGTATACTAGTTTGTAACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_139015.3-1304s1c1
Sequence:CCGGCCTGGTCTCCTACTATGCTTTCTCGAGAAAGCATAGTAGGAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139015.3-659s1c1
Sequence:CCGGAGCACCAATAATAGCATCCAACTCGAGTTGGATGCTATTATTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139015.3-660s1c1
Sequence:CCGGGCACCAATAATAGCATCCAAACTCGAGTTTGGATGCTATTATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_139015.3-1506s1c1
Sequence:CCGGCCCTTCTCTATTTGGTGCCATCTCGAGATGGCACCAAATAGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139015
VALIDATED
SPPL3 MISSION shRNA Lentiviral Transduction Particles
signal peptide peptidase like 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_139015.3-1304s21c1
Sequence:CCGGCCTGGTCTCCTACTATGCTTTCTCGAGAAAGCATAGTAGGAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_139015.3-2105s21c1
Sequence:CCGGGAAGCTCTTCTGTCGTTATATCTCGAGATATAACGACAGAAGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139015.3-1541s21c1
Sequence:CCGGCTCCTCACGATGGCCTATTTACTCGAGTAAATAGGCCATCGTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_139015.3-572s21c1
Sequence:CCGGGGTAGTTTCAGGTCCCTTAATCTCGAGATTAAGGGACCTGAAACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_139015.3-1282s21c1
Sequence:CCGGGGGCATCGGAGACATCGTTATCTCGAGATAACGATGTCTCCGATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139015.3-2477s1c1
Sequence:CCGGCCGCAGTTACAAACTAGTATACTCGAGTATACTAGTTTGTAACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_139015.3-1304s1c1
Sequence:CCGGCCTGGTCTCCTACTATGCTTTCTCGAGAAAGCATAGTAGGAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139015.3-659s1c1
Sequence:CCGGAGCACCAATAATAGCATCCAACTCGAGTTGGATGCTATTATTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139015.3-660s1c1
Sequence:CCGGGCACCAATAATAGCATCCAAACTCGAGTTTGGATGCTATTATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_139015.3-1506s1c1
Sequence:CCGGCCCTTCTCTATTTGGTGCCATCTCGAGATGGCACCAAATAGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks