EMAIL THIS PAGE TO A FRIEND

SPR

sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)

Synonyms: SDR38C1
UniProtKB ID: P35270, A8K741, D6W5H2, Q53GI9, Q9UBB1
Gene ID:
Human(6697) Summary: This gene encodes an aldo-keto reductase that catalyzes the NADPH-dependent reduction of pteridine derivatives and is important in the biosynthesis of tetrahydrobiopterin (BH4). Mutations in this gene result in DOPA-responsive dystonia due to sepiaterin reductase deficiency. A pseudogene has been identified on chromosome 1. [provided by RefSeq, Jul 2008]
Mouse(20751) sepiapterin reductase
Rat(29270) sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
fruit fly(252698) spread wings
chicken(425255) sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
fruit fly(31463) Sex peptide receptor
domestic cat(101101210) sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
dog(483118) sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
domestic guinea pig(100719412) sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
naked mole-rat(101713942) sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
cow(533836) sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
sheep(101111439) sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003124 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012911 MISSION® esiRNA esiRNA targeting human SPR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003124 Rosetta Predictions human pricing
NM_019181 Rosetta Predictions rat pricing
NM_011467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053228 predicted 761
2 SASI_Hs01_00053229 predicted 1019
3 SASI_Hs01_00053230 predicted 811
4 SASI_Hs01_00053231 predicted 826
5 SASI_Hs01_00053232 predicted 330
6 SASI_Hs01_00053233 predicted 1200
7 SASI_Hs01_00053234 predicted 996
8 SASI_Hs01_00053235 predicted 996
9 SASI_Hs01_00053236 predicted 927
10 SASI_Hs01_00053237 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261972 predicted 459
2 SASI_Rn02_00261973 predicted 456
3 SASI_Rn02_00261974 predicted 469
4 SASI_Rn02_00261975 predicted 358
5 SASI_Rn02_00261976 predicted 374
6 SASI_Rn02_00261977 predicted 461
7 SASI_Rn02_00261978 predicted 356
8 SASI_Rn02_00261979 predicted 388
9 SASI_Rn02_00261980 predicted 360
10 SASI_Rn02_00261981 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055317 predicted 400
2 SASI_Mm02_00320729 predicted 411
3 SASI_Mm01_00055313 predicted 462
4 SASI_Mm01_00055315 predicted 459
5 SASI_Mm02_00320730 predicted 391
6 SASI_Mm01_00055318 predicted 400
7 SASI_Mm02_00320731 predicted 427
8 SASI_Mm01_00055319 predicted 551
9 SASI_Mm01_00055321 predicted 375
10 SASI_Mm01_00055322 predicted 466
11 SASI_Mm01_00055314 predicted 529
12 SASI_Mm01_00055316 predicted 207
13 SASI_Mm01_00055320 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003124
VALIDATED
SPR MISSION shRNA Bacterial Glycerol Stock
sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003124.2-788s1c1
Sequence:CCGGCGTGGACTTCTATGACAAATACTCGAGTATTTGTCATAGAAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003124.2-587s1c1
Sequence:CCGGACCTAATGTGAGGGTGCTGAACTCGAGTTCAGCACCCTCACATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003124.2-464s1c1
Sequence:CCGGCCTCAACAGAACCGTGGTTAACTCGAGTTAACCACGGTTCTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003124.2-735s1c1
Sequence:CCGGGCCCAGAAACTGCTGAGCTTACTCGAGTAAGCTCAGCAGTTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003124.2-371s1c1
Sequence:CCGGCTCCACTCAAGTGAACAACTACTCGAGTAGTTGTTCACTTGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003124.4-398s21c1
Sequence:CCGGCTCCACTCAAGTGAACAACTACTCGAGTAGTTGTTCACTTGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003124.4-815s21c1
Sequence:CCGGCGTGGACTTCTATGACAAATACTCGAGTATTTGTCATAGAAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003124.4-491s21c1
Sequence:CCGGCCTCAACAGAACCGTGGTTAACTCGAGTTAACCACGGTTCTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003124.4-614s21c1
Sequence:CCGGACCTAATGTGAGGGTGCTGAACTCGAGTTCAGCACCCTCACATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003124.4-1032s21c1
Sequence:CCGGCTGTGCACCCTGGGTTATAAGCTCGAGCTTATAACCCAGGGTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003124
VALIDATED
SPR MISSION shRNA shRNA Plasmid DNA
sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003124.2-788s1c1
Sequence:CCGGCGTGGACTTCTATGACAAATACTCGAGTATTTGTCATAGAAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003124.2-587s1c1
Sequence:CCGGACCTAATGTGAGGGTGCTGAACTCGAGTTCAGCACCCTCACATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003124.2-464s1c1
Sequence:CCGGCCTCAACAGAACCGTGGTTAACTCGAGTTAACCACGGTTCTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003124.2-735s1c1
Sequence:CCGGGCCCAGAAACTGCTGAGCTTACTCGAGTAAGCTCAGCAGTTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003124.2-371s1c1
Sequence:CCGGCTCCACTCAAGTGAACAACTACTCGAGTAGTTGTTCACTTGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003124.4-398s21c1
Sequence:CCGGCTCCACTCAAGTGAACAACTACTCGAGTAGTTGTTCACTTGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003124.4-815s21c1
Sequence:CCGGCGTGGACTTCTATGACAAATACTCGAGTATTTGTCATAGAAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003124.4-491s21c1
Sequence:CCGGCCTCAACAGAACCGTGGTTAACTCGAGTTAACCACGGTTCTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003124.4-614s21c1
Sequence:CCGGACCTAATGTGAGGGTGCTGAACTCGAGTTCAGCACCCTCACATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003124.4-1032s21c1
Sequence:CCGGCTGTGCACCCTGGGTTATAAGCTCGAGCTTATAACCCAGGGTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003124
VALIDATED
SPR MISSION shRNA Lentiviral Transduction Particles
sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003124.2-788s1c1
Sequence:CCGGCGTGGACTTCTATGACAAATACTCGAGTATTTGTCATAGAAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003124.2-587s1c1
Sequence:CCGGACCTAATGTGAGGGTGCTGAACTCGAGTTCAGCACCCTCACATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003124.2-464s1c1
Sequence:CCGGCCTCAACAGAACCGTGGTTAACTCGAGTTAACCACGGTTCTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003124.2-735s1c1
Sequence:CCGGGCCCAGAAACTGCTGAGCTTACTCGAGTAAGCTCAGCAGTTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003124.2-371s1c1
Sequence:CCGGCTCCACTCAAGTGAACAACTACTCGAGTAGTTGTTCACTTGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003124.4-398s21c1
Sequence:CCGGCTCCACTCAAGTGAACAACTACTCGAGTAGTTGTTCACTTGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003124.4-815s21c1
Sequence:CCGGCGTGGACTTCTATGACAAATACTCGAGTATTTGTCATAGAAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003124.4-491s21c1
Sequence:CCGGCCTCAACAGAACCGTGGTTAACTCGAGTTAACCACGGTTCTGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003124.4-614s21c1
Sequence:CCGGACCTAATGTGAGGGTGCTGAACTCGAGTTCAGCACCCTCACATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003124.4-1032s21c1
Sequence:CCGGCTGTGCACCCTGGGTTATAAGCTCGAGCTTATAACCCAGGGTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011467
SPR MISSION shRNA Bacterial Glycerol Stock
sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-717s1c1
Sequence:CCGGGACCCAGAGTTAAGGAGCAAACTCGAGTTTGCTCCTTAACTCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-515s1c1
Sequence:CCGGCCTGAGCAAGACTGTGGTTAACTCGAGTTAACCACAGTCTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-303s1c1
Sequence:CCGGCAGCGGTTGCTGAGCGCAGTACTCGAGTACTGCGCTCAGCAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-172s1c1
Sequence:CCGGCCGGTTCCGTGATGCTCGTAACTCGAGTTACGAGCATCACGGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-738s1c1
Sequence:CCGGCTGCAGAAGTTGAAGTCGGATCTCGAGATCCGACTTCAACTTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011467
SPR MISSION shRNA shRNA Plasmid DNA
sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-717s1c1
Sequence:CCGGGACCCAGAGTTAAGGAGCAAACTCGAGTTTGCTCCTTAACTCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-515s1c1
Sequence:CCGGCCTGAGCAAGACTGTGGTTAACTCGAGTTAACCACAGTCTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-303s1c1
Sequence:CCGGCAGCGGTTGCTGAGCGCAGTACTCGAGTACTGCGCTCAGCAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-172s1c1
Sequence:CCGGCCGGTTCCGTGATGCTCGTAACTCGAGTTACGAGCATCACGGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-738s1c1
Sequence:CCGGCTGCAGAAGTTGAAGTCGGATCTCGAGATCCGACTTCAACTTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011467
SPR MISSION shRNA Lentiviral Transduction Particles
sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-717s1c1
Sequence:CCGGGACCCAGAGTTAAGGAGCAAACTCGAGTTTGCTCCTTAACTCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-515s1c1
Sequence:CCGGCCTGAGCAAGACTGTGGTTAACTCGAGTTAACCACAGTCTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-303s1c1
Sequence:CCGGCAGCGGTTGCTGAGCGCAGTACTCGAGTACTGCGCTCAGCAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-172s1c1
Sequence:CCGGCCGGTTCCGTGATGCTCGTAACTCGAGTTACGAGCATCACGGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011467.1-738s1c1
Sequence:CCGGCTGCAGAAGTTGAAGTCGGATCTCGAGATCCGACTTCAACTTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks