EMAIL THIS PAGE TO A FRIEND

SPRED1

sprouty-related, EVH1 domain containing 1

Synonyms: NFLS hSpred1 spred-1
UniProtKB ID: Q7Z699, B2RPJ8, Q05D53, Q8N256
Gene ID:
Human(161742) Summary: The protein encoded by this gene is a member of the Sprouty family of proteins and is phosphorylated by tyrosine kinase in response to several growth factors. The encoded protein can act as a homodimer or as a heterodimer with SPRED2 to regulate activation of the MAP kinase cascade. Defects in this gene are a cause of neurofibromatosis type 1-like syndrome (NFLS). [provided by RefSeq, Jul 2008]
Mouse(114715) sprouty protein with EVH-1 domain 1, related sequence
Rat(296072) sprouty-related, EVH1 domain containing 1
Zebrafish(406513) sprouty-related, EVH1 domain containing 1
dog(487485) sprouty-related, EVH1 domain containing 1
chicken(423292) sprouty-related, EVH1 domain containing 1
Horse(100057517) sprouty-related, EVH1 domain containing 1
domestic cat(101088935) sprouty-related, EVH1 domain containing 1
cow(519882) sprouty-related, EVH1 domain containing 1
sheep(101112323) sprouty-related, EVH1 domain containing 1
Domestic Rabbit(100351685) sprouty-related, EVH1 domain containing 1
naked mole-rat(101699065) sprouty-related, EVH1 domain containing 1
domestic guinea pig(100727604) sprouty-related, EVH1 domain containing 1
205 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152594 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152594 Rosetta Predictions human pricing
NM_001047089 Rosetta Predictions rat pricing
NM_033524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366433 predicted 618
2 SASI_Hs01_00189178 predicted 1451
3 SASI_Hs02_00366434 predicted 1557
4 SASI_Hs01_00189179 predicted 1525
5 SASI_Hs01_00189180 predicted 1064
6 SASI_Hs01_00189181 predicted 932
7 SASI_Hs01_00189182 predicted 1035
8 SASI_Hs02_00366435 predicted 605
9 SASI_Hs01_00189185 predicted 1644
10 SASI_Hs01_00189186 predicted 1068
11 SASI_Hs01_00189183 predicted 344
12 SASI_Hs01_00189184 predicted 837
13 SASI_Hs01_00189187 predicted 1525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205824 predicted 344
2 SASI_Rn02_00205825 predicted 515
3 SASI_Rn02_00205826 predicted 281
4 SASI_Rn02_00205827 predicted 606
5 SASI_Rn02_00205828 predicted 547
6 SASI_Rn02_00205829 predicted 223
7 SASI_Rn02_00205830 predicted 742
8 SASI_Rn02_00205831 predicted 915
9 SASI_Rn02_00205832 predicted 989
10 SASI_Rn02_00205833 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175713 predicted 487
2 SASI_Mm01_00175714 predicted 754
3 SASI_Mm01_00175715 predicted 1256
4 SASI_Mm01_00175716 predicted 1642
5 SASI_Mm01_00175717 predicted 877
6 SASI_Mm01_00175718 predicted 559
7 SASI_Mm01_00175719 predicted 1689
8 SASI_Mm01_00175720 predicted 828
9 SASI_Mm01_00175721 predicted 497
10 SASI_Mm01_00175722 predicted 1015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152594
VALIDATED
SPRED1 MISSION shRNA Bacterial Glycerol Stock
sprouty-related, EVH1 domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152594.2-1326s21c1
Sequence:CCGGGAACGTTCTCGCTGCGTATACCTCGAGGTATACGCAGCGAGAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152594.2-963s21c1
Sequence:CCGGGAATACGTACAGCGGCAAATACTCGAGTATTTGCCGCTGTACGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152594.2-1758s21c1
Sequence:CCGGGAATCTTGCCTGGTATCATTGCTCGAGCAATGATACCAGGCAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152594.1-674s1c1
Sequence:CCGGGCCAAGCCAATCAGATAACATCTCGAGATGTTATCTGATTGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152594.1-603s1c1
Sequence:CCGGGCCTTATAGAAGCTCAAATATCTCGAGATATTTGAGCTTCTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152594.1-1224s1c1
Sequence:CCGGGAGCATGTTGTATCATTGTATCTCGAGATACAATGATACAACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152594.1-514s1c1
Sequence:CCGGGCAGATGACTTACAAGCAAATCTCGAGATTTGCTTGTAAGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152594.1-874s1c1
Sequence:CCGGCGCTATGCAGACTACAGACATCTCGAGATGTCTGTAGTCTGCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152594
VALIDATED
SPRED1 MISSION shRNA shRNA Plasmid DNA
sprouty-related, EVH1 domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152594.2-1326s21c1
Sequence:CCGGGAACGTTCTCGCTGCGTATACCTCGAGGTATACGCAGCGAGAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152594.2-963s21c1
Sequence:CCGGGAATACGTACAGCGGCAAATACTCGAGTATTTGCCGCTGTACGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152594.2-1758s21c1
Sequence:CCGGGAATCTTGCCTGGTATCATTGCTCGAGCAATGATACCAGGCAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152594.1-674s1c1
Sequence:CCGGGCCAAGCCAATCAGATAACATCTCGAGATGTTATCTGATTGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152594.1-603s1c1
Sequence:CCGGGCCTTATAGAAGCTCAAATATCTCGAGATATTTGAGCTTCTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152594.1-1224s1c1
Sequence:CCGGGAGCATGTTGTATCATTGTATCTCGAGATACAATGATACAACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152594.1-514s1c1
Sequence:CCGGGCAGATGACTTACAAGCAAATCTCGAGATTTGCTTGTAAGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152594.1-874s1c1
Sequence:CCGGCGCTATGCAGACTACAGACATCTCGAGATGTCTGTAGTCTGCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152594
VALIDATED
SPRED1 MISSION shRNA Lentiviral Transduction Particles
sprouty-related, EVH1 domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152594.2-1326s21c1
Sequence:CCGGGAACGTTCTCGCTGCGTATACCTCGAGGTATACGCAGCGAGAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152594.2-963s21c1
Sequence:CCGGGAATACGTACAGCGGCAAATACTCGAGTATTTGCCGCTGTACGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152594.2-1758s21c1
Sequence:CCGGGAATCTTGCCTGGTATCATTGCTCGAGCAATGATACCAGGCAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152594.1-674s1c1
Sequence:CCGGGCCAAGCCAATCAGATAACATCTCGAGATGTTATCTGATTGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152594.1-603s1c1
Sequence:CCGGGCCTTATAGAAGCTCAAATATCTCGAGATATTTGAGCTTCTATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152594.1-1224s1c1
Sequence:CCGGGAGCATGTTGTATCATTGTATCTCGAGATACAATGATACAACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152594.1-514s1c1
Sequence:CCGGGCAGATGACTTACAAGCAAATCTCGAGATTTGCTTGTAAGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152594.1-874s1c1
Sequence:CCGGCGCTATGCAGACTACAGACATCTCGAGATGTCTGTAGTCTGCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033524
VALIDATED
SPRED1 MISSION shRNA Bacterial Glycerol Stock
sprouty-related, EVH1 domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033524.2-906s21c1
Sequence:CCGGGAATATGTACAGCGGCAAATACTCGAGTATTTGCCGCTGTACATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033524.2-1387s21c1
Sequence:CCGGGTGCTGAGAGCATGCTATATCCTCGAGGATATAGCATGCTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033524.2-777s21c1
Sequence:CCGGCCTTACAGAAGCTCAGACATACTCGAGTATGTCTGAGCTTCTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033524.2-2381s21c1
Sequence:CCGGGCACAGATGTAATTGTCTAATCTCGAGATTAGACAATTACATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033524.2-1266s21c1
Sequence:CCGGGAACGTTCTCGCTGCGTATACCTCGAGGTATACGCAGCGAGAACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033524.2-1462s1c1
Sequence:CCGGGCGATGACAAGTTCTGCCTAACTCGAGTTAGGCAGAACTTGTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033524.2-928s1c1
Sequence:CCGGCTAAGGAATGTGGGAGCCTAACTCGAGTTAGGCTCCCACATTCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033524.2-414s1c1
Sequence:CCGGGTCCCTCATCAGGAAGAGAATCTCGAGATTCTCTTCCTGATGAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033524.2-2381s1c1
Sequence:CCGGGCACAGATGTAATTGTCTAATCTCGAGATTAGACAATTACATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033524.2-777s1c1
Sequence:CCGGCCTTACAGAAGCTCAGACATACTCGAGTATGTCTGAGCTTCTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033524
VALIDATED
SPRED1 MISSION shRNA shRNA Plasmid DNA
sprouty-related, EVH1 domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033524.2-906s21c1
Sequence:CCGGGAATATGTACAGCGGCAAATACTCGAGTATTTGCCGCTGTACATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033524.2-1387s21c1
Sequence:CCGGGTGCTGAGAGCATGCTATATCCTCGAGGATATAGCATGCTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033524.2-777s21c1
Sequence:CCGGCCTTACAGAAGCTCAGACATACTCGAGTATGTCTGAGCTTCTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033524.2-2381s21c1
Sequence:CCGGGCACAGATGTAATTGTCTAATCTCGAGATTAGACAATTACATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033524.2-1266s21c1
Sequence:CCGGGAACGTTCTCGCTGCGTATACCTCGAGGTATACGCAGCGAGAACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033524.2-1462s1c1
Sequence:CCGGGCGATGACAAGTTCTGCCTAACTCGAGTTAGGCAGAACTTGTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033524.2-928s1c1
Sequence:CCGGCTAAGGAATGTGGGAGCCTAACTCGAGTTAGGCTCCCACATTCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033524.2-414s1c1
Sequence:CCGGGTCCCTCATCAGGAAGAGAATCTCGAGATTCTCTTCCTGATGAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033524.2-2381s1c1
Sequence:CCGGGCACAGATGTAATTGTCTAATCTCGAGATTAGACAATTACATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033524.2-777s1c1
Sequence:CCGGCCTTACAGAAGCTCAGACATACTCGAGTATGTCTGAGCTTCTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033524
VALIDATED
SPRED1 MISSION shRNA Lentiviral Transduction Particles
sprouty-related, EVH1 domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033524.2-906s21c1
Sequence:CCGGGAATATGTACAGCGGCAAATACTCGAGTATTTGCCGCTGTACATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033524.2-1387s21c1
Sequence:CCGGGTGCTGAGAGCATGCTATATCCTCGAGGATATAGCATGCTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033524.2-777s21c1
Sequence:CCGGCCTTACAGAAGCTCAGACATACTCGAGTATGTCTGAGCTTCTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033524.2-2381s21c1
Sequence:CCGGGCACAGATGTAATTGTCTAATCTCGAGATTAGACAATTACATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_033524.2-1266s21c1
Sequence:CCGGGAACGTTCTCGCTGCGTATACCTCGAGGTATACGCAGCGAGAACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033524.2-1462s1c1
Sequence:CCGGGCGATGACAAGTTCTGCCTAACTCGAGTTAGGCAGAACTTGTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033524.2-928s1c1
Sequence:CCGGCTAAGGAATGTGGGAGCCTAACTCGAGTTAGGCTCCCACATTCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033524.2-414s1c1
Sequence:CCGGGTCCCTCATCAGGAAGAGAATCTCGAGATTCTCTTCCTGATGAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033524.2-2381s1c1
Sequence:CCGGGCACAGATGTAATTGTCTAATCTCGAGATTAGACAATTACATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_033524.2-777s1c1
Sequence:CCGGCCTTACAGAAGCTCAGACATACTCGAGTATGTCTGAGCTTCTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks