EMAIL THIS PAGE TO A FRIEND

SPRED3

sprouty-related, EVH1 domain containing 3

Synonyms: Eve-3 spred-3
UniProtKB ID: Q2MJR0, Q2MJR1
Gene ID:
Human(399473) Summary: This gene encodes a protein with a C-terminal Sprouty-like cysteine-rich domain (SRY) and an N-terminal Ena/Vasodilator-stimulated phosphoprotein (VASP) homology-1 (EVH-1) domain. The encoded protein is a member of a family of proteins that negatively regulates mitogen-activated protein (MAP) kinase signaling, particularly during organogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Mouse(101809) sprouty-related, EVH1 domain containing 3
Rat(308478) sprouty-related, EVH1 domain containing 3
Zebrafish(568925) sprouty-related, EVH1 domain containing 3
dog(612575) sprouty-related, EVH1 domain containing 3
domestic cat(101094970) sprouty-related, EVH1 domain containing 3
cow(613633) sprouty-related, EVH1 domain containing 3
sheep(101112083) sprouty-related, EVH1 domain containing 3
naked mole-rat(101707157) sprouty-related, EVH1 domain containing 3
domestic guinea pig(100732092) sprouty-related, EVH1 domain containing 3
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303213 ANTI-SPRED3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
PRS4851 Anti-Spred3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039616 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039616 Rosetta Predictions human pricing
NM_001042522 Rosetta Predictions human pricing
XM_001078570 Rosetta Predictions rat pricing
XM_218461 Rosetta Predictions rat pricing
NM_182927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207574 predicted 425
2 SASI_Hs01_00207575 predicted 200
3 SASI_Hs01_00207576 predicted 417
4 SASI_Hs01_00207577 predicted 206
5 SASI_Hs01_00207578 predicted 260
6 SASI_Hs01_00207579 predicted 298
7 SASI_Hs01_00207580 predicted 253
8 SASI_Hs01_00207581 predicted 177
9 SASI_Hs01_00207582 predicted 218
10 SASI_Hs01_00207583 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310338 predicted 201
2 SASI_Hs02_00310339 predicted 568
3 SASI_Hs02_00310340 predicted 209
4 SASI_Hs02_00310341 predicted 261
5 SASI_Hs02_00310342 predicted 904
6 SASI_Hs02_00310343 predicted 297
7 SASI_Hs02_00310344 predicted 436
8 SASI_Hs02_00310345 predicted 251
9 SASI_Hs02_00310346 predicted 185
10 SASI_Hs02_00310347 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361289 predicted 1320
2 SASI_Rn02_00361290 predicted 1314
3 SASI_Rn02_00361291 predicted 1204
4 SASI_Rn02_00361292 predicted 1418
5 SASI_Rn02_00361293 predicted 967
6 SASI_Rn02_00361294 predicted 1291
7 SASI_Rn02_00361295 predicted 1360
8 SASI_Rn02_00361296 predicted 1244
9 SASI_Rn02_00361297 predicted 1410
10 SASI_Rn02_00361298 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377753 predicted 1372
2 SASI_Rn02_00377754 predicted 1361
3 SASI_Rn02_00377755 predicted 1254
4 SASI_Rn02_00377756 predicted 1371
5 SASI_Rn02_00377757 predicted 1339
6 SASI_Rn02_00377758 predicted 1399
7 SASI_Rn02_00377759 predicted 1296
8 SASI_Rn02_00377760 predicted 1352
9 SASI_Rn02_00377761 predicted 1427
10 SASI_Rn02_00377762 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173583 predicted 1735
2 SASI_Mm01_00173584 predicted 1589
3 SASI_Mm01_00173585 predicted 1748
4 SASI_Mm01_00173586 predicted 1845
5 SASI_Mm01_00173587 predicted 1094
6 SASI_Mm01_00173588 predicted 1449
7 SASI_Mm01_00173589 predicted 1757
8 SASI_Mm02_00349983 predicted 1555
9 SASI_Mm01_00173591 predicted 1707
10 SASI_Mm01_00173592 predicted 1437
11 SASI_Mm01_00173590 predicted 1570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039616
SPRED3 MISSION shRNA Bacterial Glycerol Stock
sprouty-related, EVH1 domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-182s21c1
Sequence:CCGGACAACCTTGGAGTGTACACTGCTCGAGCAGTGTACACTCCAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-213s21c1
Sequence:CCGGTGGTTTACAACAAGGTGAATCCTCGAGGATTCACCTTGTTGTAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-298s21c1
Sequence:CCGGGGCTGATGAGTTCCAGAAGAGCTCGAGCTCTTCTGGAACTCATCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-236s21c1
Sequence:CCGGATCTTTCACCACTGGAGCCTGCTCGAGCAGGCTCCAGTGGTGAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-265s21c1
Sequence:CCGGCAAGTTTGGACTGACGTTTCACTCGAGTGAAACGTCAGTCCAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039616
SPRED3 MISSION shRNA shRNA Plasmid DNA
sprouty-related, EVH1 domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-182s21c1
Sequence:CCGGACAACCTTGGAGTGTACACTGCTCGAGCAGTGTACACTCCAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-213s21c1
Sequence:CCGGTGGTTTACAACAAGGTGAATCCTCGAGGATTCACCTTGTTGTAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-298s21c1
Sequence:CCGGGGCTGATGAGTTCCAGAAGAGCTCGAGCTCTTCTGGAACTCATCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-236s21c1
Sequence:CCGGATCTTTCACCACTGGAGCCTGCTCGAGCAGGCTCCAGTGGTGAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-265s21c1
Sequence:CCGGCAAGTTTGGACTGACGTTTCACTCGAGTGAAACGTCAGTCCAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039616
SPRED3 MISSION shRNA Lentiviral Transduction Particles
sprouty-related, EVH1 domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-182s21c1
Sequence:CCGGACAACCTTGGAGTGTACACTGCTCGAGCAGTGTACACTCCAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-213s21c1
Sequence:CCGGTGGTTTACAACAAGGTGAATCCTCGAGGATTCACCTTGTTGTAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-298s21c1
Sequence:CCGGGGCTGATGAGTTCCAGAAGAGCTCGAGCTCTTCTGGAACTCATCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-236s21c1
Sequence:CCGGATCTTTCACCACTGGAGCCTGCTCGAGCAGGCTCCAGTGGTGAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039616.1-265s21c1
Sequence:CCGGCAAGTTTGGACTGACGTTTCACTCGAGTGAAACGTCAGTCCAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182927
SPRED3 MISSION shRNA Bacterial Glycerol Stock
sprouty-related, EVH1 domain containing 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000103465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182927.2-1595s1c1
Sequence:CCGGCCCACTGAGAAGACTTAGAATCTCGAGATTCTAAGTCTTCTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182927.2-713s1c1
Sequence:CCGGTCACTGGGATTCCTGAACCTTCTCGAGAAGGTTCAGGAATCCCAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182927.2-333s1c1
Sequence:CCGGGCCAGGTTTGGTTTACAACAACTCGAGTTGTTGTAAACCAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182927.2-846s1c1
Sequence:CCGGCTTTGCCAAGACTGGTGCATTCTCGAGAATGCACCAGTCTTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182927
SPRED3 MISSION shRNA shRNA Plasmid DNA
sprouty-related, EVH1 domain containing 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000103465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182927.2-1595s1c1
Sequence:CCGGCCCACTGAGAAGACTTAGAATCTCGAGATTCTAAGTCTTCTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182927.2-713s1c1
Sequence:CCGGTCACTGGGATTCCTGAACCTTCTCGAGAAGGTTCAGGAATCCCAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182927.2-333s1c1
Sequence:CCGGGCCAGGTTTGGTTTACAACAACTCGAGTTGTTGTAAACCAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182927.2-846s1c1
Sequence:CCGGCTTTGCCAAGACTGGTGCATTCTCGAGAATGCACCAGTCTTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182927
SPRED3 MISSION shRNA Lentiviral Transduction Particles
sprouty-related, EVH1 domain containing 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000103465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182927.2-1595s1c1
Sequence:CCGGCCCACTGAGAAGACTTAGAATCTCGAGATTCTAAGTCTTCTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182927.2-713s1c1
Sequence:CCGGTCACTGGGATTCCTGAACCTTCTCGAGAAGGTTCAGGAATCCCAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182927.2-333s1c1
Sequence:CCGGGCCAGGTTTGGTTTACAACAACTCGAGTTGTTGTAAACCAAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182927.2-846s1c1
Sequence:CCGGCTTTGCCAAGACTGGTGCATTCTCGAGAATGCACCAGTCTTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks