EMAIL THIS PAGE TO A FRIEND

SPRN

shadow of prion protein homolog (zebrafish)

Synonyms: SHADOO SHO bA108K14.1
UniProtKB ID: Q5BIV9
Gene ID:
Mouse(212518) shadow of prion protein
Rat(541462) shadow of prion protein homolog (zebrafish)
Zebrafish(386702) shadow of prion protein
domestic guinea pig(100728202) shadow of prion protein homolog (zebrafish)
cow(616266) shadow of prion protein homolog (zebrafish)
sheep(100302330) shadow of prion protein homolog (zebrafish)
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301600 ANTI-SPRN (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB4301026 Anti-SPRN antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183147 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183147 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183147 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012508 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141881 MISSION® esiRNA esiRNA human SPRN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012508 Rosetta Predictions human pricing
NM_001031845 Rosetta Predictions rat pricing
NM_183147 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046058 predicted 1299
2 SASI_Hs01_00046059 predicted 2485
3 SASI_Hs02_00306171 predicted 3138
4 SASI_Hs01_00046060 predicted 1298
5 SASI_Hs01_00046061 predicted 2501
6 SASI_Hs01_00046062 predicted 1406
7 SASI_Hs01_00046063 predicted 2326
8 SASI_Hs01_00046064 predicted 2488
9 SASI_Hs01_00046065 predicted 1305
10 SASI_Hs01_00046067 predicted 1389
11 SASI_Hs01_00046066 predicted 1748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062735 predicted 404
2 SASI_Rn02_00203615 predicted 45
3 SASI_Rn01_00062737 predicted 379
4 SASI_Rn01_00062738 predicted 377
5 SASI_Rn01_00062739 predicted 75
6 SASI_Rn01_00062740 predicted 405
7 SASI_Rn01_00062741 predicted 405
8 SASI_Rn02_00203616 predicted 234
9 SASI_Rn01_00062742 predicted 38
10 SASI_Rn01_00062743 predicted 369
11 SASI_Rn01_00062736 predicted 287
12 SASI_Rn01_00062744 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350180 predicted 431
2 SASI_Mm02_00350181 predicted 981
3 SASI_Mm02_00350182 predicted 962
4 SASI_Mm02_00350183 predicted 973
5 SASI_Mm02_00350184 predicted 876
6 SASI_Mm02_00350185 predicted 970
7 SASI_Mm02_00350186 predicted 711
8 SASI_Mm02_00350187 predicted 770
9 SASI_Mm02_00350188 predicted 790
10 SASI_Mm02_00350189 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183147
SPRN MISSION shRNA Bacterial Glycerol Stock
shadow of prion protein homolog (zebrafish)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-935s1c1
Sequence:CCGGCCGTCTGATTCTGCCACTAAACTCGAGTTTAGTGGCAGAATCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-1068s1c1
Sequence:CCGGGCAGGTCCCAATGATGTCATACTCGAGTATGACATCATTGGGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-1614s1c1
Sequence:CCGGGCTCTCTCTGACCATCCATATCTCGAGATATGGATGGTCAGAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-1375s1c1
Sequence:CCGGCCAAACTGCAAGATTCCCATACTCGAGTATGGGAATCTTGCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-1690s1c1
Sequence:CCGGCCTCACAAGAATCTACCTTTACTCGAGTAAAGGTAGATTCTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183147
SPRN MISSION shRNA shRNA Plasmid DNA
shadow of prion protein homolog (zebrafish)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-935s1c1
Sequence:CCGGCCGTCTGATTCTGCCACTAAACTCGAGTTTAGTGGCAGAATCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-1068s1c1
Sequence:CCGGGCAGGTCCCAATGATGTCATACTCGAGTATGACATCATTGGGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-1614s1c1
Sequence:CCGGGCTCTCTCTGACCATCCATATCTCGAGATATGGATGGTCAGAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-1375s1c1
Sequence:CCGGCCAAACTGCAAGATTCCCATACTCGAGTATGGGAATCTTGCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-1690s1c1
Sequence:CCGGCCTCACAAGAATCTACCTTTACTCGAGTAAAGGTAGATTCTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183147
SPRN MISSION shRNA Lentiviral Transduction Particles
shadow of prion protein homolog (zebrafish)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-935s1c1
Sequence:CCGGCCGTCTGATTCTGCCACTAAACTCGAGTTTAGTGGCAGAATCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-1068s1c1
Sequence:CCGGGCAGGTCCCAATGATGTCATACTCGAGTATGACATCATTGGGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-1614s1c1
Sequence:CCGGGCTCTCTCTGACCATCCATATCTCGAGATATGGATGGTCAGAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180312    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-1375s1c1
Sequence:CCGGCCAAACTGCAAGATTCCCATACTCGAGTATGGGAATCTTGCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183147.2-1690s1c1
Sequence:CCGGCCTCACAAGAATCTACCTTTACTCGAGTAAAGGTAGATTCTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012508
SPRN MISSION shRNA Bacterial Glycerol Stock
shadow of prion protein homolog (zebrafish)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1133s1c1
Sequence:CCGGCACTGCAAGCTGATGGAATGTCTCGAGACATTCCATCAGCTTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1457s1c1
Sequence:CCGGGCAGCACCTTAGTCCATACTACTCGAGTAGTATGGACTAAGGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1662s1c1
Sequence:CCGGCTTCCAGTCATTGCACAGCAACTCGAGTTGCTGTGCAATGACTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.2-1334s1c1
Sequence:CCGGCCAGAGCTTTCCAAGTCCTTTCTCGAGAAAGGACTTGGAAAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165076    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1137s1c1
Sequence:CCGGGCAAGCTGATGGAATGTTCCACTCGAGTGGAACATTCCATCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161413    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1187s1c1
Sequence:CCGGGACTGTTGATTCAGCACATTACTCGAGTAATGTGCTGAATCAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.2-1259s1c1
Sequence:CCGGCTTTGCTCCAACAACTTGAAACTCGAGTTTCAAGTTGTTGGAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.2-1015s1c1
Sequence:CCGGGAAGCAGTGAAATGGACCAAACTCGAGTTTGGTCCATTTCACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164734    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.2-1255s1c1
Sequence:CCGGCCCACTTTGCTCCAACAACTTCTCGAGAAGTTGTTGGAGCAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012508
SPRN MISSION shRNA shRNA Plasmid DNA
shadow of prion protein homolog (zebrafish)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1133s1c1
Sequence:CCGGCACTGCAAGCTGATGGAATGTCTCGAGACATTCCATCAGCTTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1457s1c1
Sequence:CCGGGCAGCACCTTAGTCCATACTACTCGAGTAGTATGGACTAAGGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1662s1c1
Sequence:CCGGCTTCCAGTCATTGCACAGCAACTCGAGTTGCTGTGCAATGACTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.2-1334s1c1
Sequence:CCGGCCAGAGCTTTCCAAGTCCTTTCTCGAGAAAGGACTTGGAAAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165076    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1137s1c1
Sequence:CCGGGCAAGCTGATGGAATGTTCCACTCGAGTGGAACATTCCATCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161413    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1187s1c1
Sequence:CCGGGACTGTTGATTCAGCACATTACTCGAGTAATGTGCTGAATCAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.2-1259s1c1
Sequence:CCGGCTTTGCTCCAACAACTTGAAACTCGAGTTTCAAGTTGTTGGAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.2-1015s1c1
Sequence:CCGGGAAGCAGTGAAATGGACCAAACTCGAGTTTGGTCCATTTCACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164734    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.2-1255s1c1
Sequence:CCGGCCCACTTTGCTCCAACAACTTCTCGAGAAGTTGTTGGAGCAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012508
SPRN MISSION shRNA Lentiviral Transduction Particles
shadow of prion protein homolog (zebrafish)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1133s1c1
Sequence:CCGGCACTGCAAGCTGATGGAATGTCTCGAGACATTCCATCAGCTTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1457s1c1
Sequence:CCGGGCAGCACCTTAGTCCATACTACTCGAGTAGTATGGACTAAGGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1662s1c1
Sequence:CCGGCTTCCAGTCATTGCACAGCAACTCGAGTTGCTGTGCAATGACTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165747    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.2-1334s1c1
Sequence:CCGGCCAGAGCTTTCCAAGTCCTTTCTCGAGAAAGGACTTGGAAAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165076    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1137s1c1
Sequence:CCGGGCAAGCTGATGGAATGTTCCACTCGAGTGGAACATTCCATCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161413    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.1-1187s1c1
Sequence:CCGGGACTGTTGATTCAGCACATTACTCGAGTAATGTGCTGAATCAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162134    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.2-1259s1c1
Sequence:CCGGCTTTGCTCCAACAACTTGAAACTCGAGTTTCAAGTTGTTGGAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163544    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.2-1015s1c1
Sequence:CCGGGAAGCAGTGAAATGGACCAAACTCGAGTTTGGTCCATTTCACTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164734    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012508.2-1255s1c1
Sequence:CCGGCCCACTTTGCTCCAACAACTTCTCGAGAAGTTGTTGGAGCAAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks