EMAIL THIS PAGE TO A FRIEND

SPRNP1

shadow of prion protein homolog (zebrafish) pseudogene 1

Species: Human SPRNP1(399833)
Gene ID:
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001678 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001678 Rosetta Predictions human pricing
XR_040356 Rosetta Predictions human pricing
XR_040357 Rosetta Predictions human pricing
XR_040358 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112004 predicted 967
2 SASI_Hs01_00112005 predicted 977
3 SASI_Hs01_00112006 predicted 1082
4 SASI_Hs01_00112007 predicted 1242
5 SASI_Hs01_00112008 predicted 1368
6 SASI_Hs01_00112009 predicted 1020
7 SASI_Hs01_00112010 predicted 970
8 SASI_Hs01_00112011 predicted 1500
9 SASI_Hs01_00112012 predicted 1014
10 SASI_Hs01_00112013 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518129 predicted 488
2 SASI_Hs02_00518130 predicted 627
3 SASI_Hs02_00518131 predicted 567
4 SASI_Hs02_00518132 predicted 564
5 SASI_Hs02_00518133 predicted 507
6 SASI_Hs02_00518134 predicted 520
7 SASI_Hs02_00518135 predicted 519
8 SASI_Hs02_00518136 predicted 517
9 SASI_Hs02_00518137 predicted 519
10 SASI_Hs02_00518138 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518139 predicted 491
2 SASI_Hs02_00518140 predicted 561
3 SASI_Hs02_00518141 predicted 568
4 SASI_Hs02_00518142 predicted 507
5 SASI_Hs02_00518143 predicted 585
6 SASI_Hs02_00518144 predicted 521
7 SASI_Hs02_00518145 predicted 517
8 SASI_Hs02_00518146 predicted 512
9 SASI_Hs02_00518147 predicted 512
10 SASI_Hs02_00518148 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518149 predicted 556
2 SASI_Hs02_00518150 predicted 702
3 SASI_Hs02_00518151 predicted 419
4 SASI_Hs02_00518152 predicted 640
5 SASI_Hs02_00518153 predicted 641
6 SASI_Hs02_00518154 predicted 584
7 SASI_Hs02_00518155 predicted 591
8 SASI_Hs02_00518156 predicted 596
9 SASI_Hs02_00518157 predicted 584
10 SASI_Hs02_00518158 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001678
SPRNP1 MISSION shRNA Bacterial Glycerol Stock
shadow of prion protein homolog (zebrafish) pseudogene 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000168167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001678.1-2246s1c1
Sequence:CCGGCCCTAACAACACTAAGCCTAACTCGAGTTAGGCTTAGTGTTGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001678.1-2096s1c1
Sequence:CCGGGCCATAAACCTAACACCCAAACTCGAGTTTGGGTGTTAGGTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001678.1-974s1c1
Sequence:CCGGCATCTACAGCTACTGTACGTGCTCGAGCACGTACAGTAGCTGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001678.1-2118s1c1
Sequence:CCGGCCAAACTCGAACCTATGCCTACTCGAGTAGGCATAGGTTCGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001678
SPRNP1 MISSION shRNA shRNA Plasmid DNA
shadow of prion protein homolog (zebrafish) pseudogene 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000168167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001678.1-2246s1c1
Sequence:CCGGCCCTAACAACACTAAGCCTAACTCGAGTTAGGCTTAGTGTTGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001678.1-2096s1c1
Sequence:CCGGGCCATAAACCTAACACCCAAACTCGAGTTTGGGTGTTAGGTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001678.1-974s1c1
Sequence:CCGGCATCTACAGCTACTGTACGTGCTCGAGCACGTACAGTAGCTGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001678.1-2118s1c1
Sequence:CCGGCCAAACTCGAACCTATGCCTACTCGAGTAGGCATAGGTTCGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001678
SPRNP1 MISSION shRNA Lentiviral Transduction Particles
shadow of prion protein homolog (zebrafish) pseudogene 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000168167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001678.1-2246s1c1
Sequence:CCGGCCCTAACAACACTAAGCCTAACTCGAGTTAGGCTTAGTGTTGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001678.1-2096s1c1
Sequence:CCGGGCCATAAACCTAACACCCAAACTCGAGTTTGGGTGTTAGGTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001678.1-974s1c1
Sequence:CCGGCATCTACAGCTACTGTACGTGCTCGAGCACGTACAGTAGCTGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001678.1-2118s1c1
Sequence:CCGGCCAAACTCGAACCTATGCCTACTCGAGTAGGCATAGGTTCGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks