EMAIL THIS PAGE TO A FRIEND

SPRR1A

small proline-rich protein 1A

Synonyms: SPRK
UniProtKB ID: P35321, B1AN47, D3DV31, Q2M303, Q9UDG4
Gene ID:
Mouse(20753) small proline-rich protein 1A
Rat(499660) small proline-rich protein 1A
domestic guinea pig(100721111) small proline-rich protein 1A
sheep(101102105) small proline-rich protein 1A
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005987 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005987 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005987 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005987 Rosetta Predictions human pricing
XM_001056859 Rosetta Predictions rat pricing
XM_574984 Rosetta Predictions rat pricing
NM_009264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120362 predicted 358
2 SASI_Hs01_00120363 predicted 268
3 SASI_Hs01_00120364 predicted 352
4 SASI_Hs01_00120366 predicted 409
5 SASI_Hs01_00120367 predicted 384
6 SASI_Hs01_00120369 predicted 423
7 SASI_Hs01_00120370 predicted 363
8 SASI_Hs01_00120371 predicted 275
9 SASI_Hs02_00340679 predicted 364
10 SASI_Hs01_00120365 predicted 377
11 SASI_Hs01_00120368 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284701 predicted 769
2 SASI_Rn02_00284702 predicted 229
3 SASI_Rn02_00284703 predicted 689
4 SASI_Rn02_00284704 predicted 703
5 SASI_Rn02_00284705 predicted 739
6 SASI_Rn02_00284706 predicted 772
7 SASI_Rn02_00284707 predicted 334
8 SASI_Rn02_00284708 predicted 692
9 SASI_Rn02_00284709 predicted 728
10 SASI_Rn02_00284710 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125452 predicted 769
2 SASI_Rn01_00125453 predicted 231
3 SASI_Rn02_00402868 predicted 698
4 SASI_Rn01_00125454 predicted 699
5 SASI_Rn01_00125455 predicted 735
6 SASI_Rn01_00125456 predicted 772
7 SASI_Rn01_00125458 predicted 330
8 SASI_Rn02_00402869 predicted 691
9 SASI_Rn01_00125459 predicted 729
10 SASI_Rn01_00125460 predicted 333
11 SASI_Rn01_00125457 predicted 664
12 SASI_Rn01_00125461 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190229 predicted 475
2 SASI_Mm01_00190230 predicted 502
3 SASI_Mm01_00190231 predicted 440
4 SASI_Mm01_00190232 predicted 469
5 SASI_Mm01_00190233 predicted 535
6 SASI_Mm01_00190234 predicted 562
7 SASI_Mm01_00190235 predicted 554
8 SASI_Mm01_00190236 predicted 528
9 SASI_Mm01_00190237 predicted 350
10 SASI_Mm01_00190238 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005987
SPRR1A MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 1A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005987.2-313s1c1
Sequence:CCGGGCAGAAGACCAAGCAGAAGTACTCGAGTACTTCTGCTTGGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-391s1c1
Sequence:CCGGCCATTCTGCTTATGAATCCCACTCGAGTGGGATTCATAAGCAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-398s1c1
Sequence:CCGGGCTTATGAATCCCATTTGCCTCTCGAGAGGCAAATGGGATTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-448s1c1
Sequence:CCGGCTGAATCATAATCGCTCCTTTCTCGAGAAAGGAGCGATTATGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161261    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-439s1c1
Sequence:CCGGGCTGTCACCCTGAATCATAATCTCGAGATTATGATTCAGGGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-447s1c1
Sequence:CCGGCCTGAATCATAATCGCTCCTTCTCGAGAAGGAGCGATTATGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005987
SPRR1A MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 1A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005987.2-313s1c1
Sequence:CCGGGCAGAAGACCAAGCAGAAGTACTCGAGTACTTCTGCTTGGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-391s1c1
Sequence:CCGGCCATTCTGCTTATGAATCCCACTCGAGTGGGATTCATAAGCAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-398s1c1
Sequence:CCGGGCTTATGAATCCCATTTGCCTCTCGAGAGGCAAATGGGATTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-448s1c1
Sequence:CCGGCTGAATCATAATCGCTCCTTTCTCGAGAAAGGAGCGATTATGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161261    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-439s1c1
Sequence:CCGGGCTGTCACCCTGAATCATAATCTCGAGATTATGATTCAGGGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-447s1c1
Sequence:CCGGCCTGAATCATAATCGCTCCTTCTCGAGAAGGAGCGATTATGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005987
SPRR1A MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 1A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005987.2-313s1c1
Sequence:CCGGGCAGAAGACCAAGCAGAAGTACTCGAGTACTTCTGCTTGGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-391s1c1
Sequence:CCGGCCATTCTGCTTATGAATCCCACTCGAGTGGGATTCATAAGCAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-398s1c1
Sequence:CCGGGCTTATGAATCCCATTTGCCTCTCGAGAGGCAAATGGGATTCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-448s1c1
Sequence:CCGGCTGAATCATAATCGCTCCTTTCTCGAGAAAGGAGCGATTATGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161261    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-439s1c1
Sequence:CCGGGCTGTCACCCTGAATCATAATCTCGAGATTATGATTCAGGGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005987.2-447s1c1
Sequence:CCGGCCTGAATCATAATCGCTCCTTCTCGAGAAGGAGCGATTATGATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009264
VALIDATED
SPRR1A MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 1A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009264.2-532s1c1
Sequence:CCGGGCTGCTGTCTATCCTGCTTATCTCGAGATAAGCAGGATAGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009264.2-440s1c1
Sequence:CCGGCAACTGTCACTCCATCACCATCTCGAGATGGTGATGGAGTGACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009264.2-465s1c1
Sequence:CCGGGCAGAAGACAAAGCAGAAGTACTCGAGTACTTCTGCTTTGTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009264.2-454s1c1
Sequence:CCGGTCACCATACCAGCAGAAGACACTCGAGTGTCTTCTGCTGGTATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009264.2-444s1c1
Sequence:CCGGTGTCACTCCATCACCATACCACTCGAGTGGTATGGTGATGGAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009264
VALIDATED
SPRR1A MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 1A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009264.2-532s1c1
Sequence:CCGGGCTGCTGTCTATCCTGCTTATCTCGAGATAAGCAGGATAGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009264.2-440s1c1
Sequence:CCGGCAACTGTCACTCCATCACCATCTCGAGATGGTGATGGAGTGACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009264.2-465s1c1
Sequence:CCGGGCAGAAGACAAAGCAGAAGTACTCGAGTACTTCTGCTTTGTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009264.2-454s1c1
Sequence:CCGGTCACCATACCAGCAGAAGACACTCGAGTGTCTTCTGCTGGTATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009264.2-444s1c1
Sequence:CCGGTGTCACTCCATCACCATACCACTCGAGTGGTATGGTGATGGAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009264
VALIDATED
SPRR1A MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 1A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009264.2-532s1c1
Sequence:CCGGGCTGCTGTCTATCCTGCTTATCTCGAGATAAGCAGGATAGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009264.2-440s1c1
Sequence:CCGGCAACTGTCACTCCATCACCATCTCGAGATGGTGATGGAGTGACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009264.2-465s1c1
Sequence:CCGGGCAGAAGACAAAGCAGAAGTACTCGAGTACTTCTGCTTTGTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009264.2-454s1c1
Sequence:CCGGTCACCATACCAGCAGAAGACACTCGAGTGTCTTCTGCTGGTATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009264.2-444s1c1
Sequence:CCGGTGTCACTCCATCACCATACCACTCGAGTGGTATGGTGATGGAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks