EMAIL THIS PAGE TO A FRIEND

SPRR1B

small proline-rich protein 1B

Synonyms: CORNIFIN GADD33 SPRR1
UniProtKB ID: P22528, B2R5H7, P22529, P22530, Q5T524
Gene ID:
Mouse(20754) small proline-rich protein 1B
Rat(685912) small proline-rich protein 1B
sheep(101102353) small proline-rich protein 1B
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301567 ANTI-SPRR1B (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2107798 Anti-SPRR1B antibody produced in rabbit affinity isolated antibody rabbit, human, horse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009265 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009265 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009265 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003125 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108941 MISSION® esiRNA esiRNA human SPRR1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003125 Rosetta Predictions human pricing
XM_001065728 Rosetta Predictions rat pricing
NM_009265 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025398 predicted 388
2 SASI_Hs01_00025399 predicted 391
3 SASI_Hs01_00025403 predicted 376
4 SASI_Hs01_00025397 predicted 270
5 SASI_Hs01_00025400 predicted 266
6 SASI_Hs01_00025401 predicted 274
7 SASI_Hs01_00025402 predicted 279
8 SASI_Hs01_00025404 predicted 449
9 SASI_Hs02_00335109 predicted 529
10 SASI_Hs01_00025405 predicted 486
11 SASI_Hs01_00025406 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315170 predicted 88
2 SASI_Rn02_00315171 predicted 284
3 SASI_Rn02_00315172 predicted 129
4 SASI_Rn02_00315173 predicted 89
5 SASI_Rn02_00315174 predicted 98
6 SASI_Rn02_00315175 predicted 25
7 SASI_Rn02_00315176 predicted 110
8 SASI_Rn02_00315177 predicted 15
9 SASI_Rn02_00315178 predicted 21
10 SASI_Rn02_00315179 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148218 predicted 409
2 SASI_Mm01_00148219 predicted 216
3 SASI_Mm01_00148220 predicted 413
4 SASI_Mm01_00148222 predicted 753
5 SASI_Mm01_00148223 predicted 146
6 SASI_Mm01_00148224 predicted 550
7 SASI_Mm01_00148225 predicted 565
8 SASI_Mm01_00148226 predicted 718
9 SASI_Mm01_00148227 predicted 722
10 SASI_Mm02_00315747 predicted 480
11 SASI_Mm01_00148221 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009265
VALIDATED
SPRR1B MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 1B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009265.2-571s1c1
Sequence:CCGGGCCTCAATTTGCATTCTGTTTCTCGAGAAACAGAATGCAAATTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009265.2-474s1c1
Sequence:CCGGCCCTCAACTGTCACTCCAATACTCGAGTATTGGAGTGACAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009265.2-483s1c1
Sequence:CCGGGTCACTCCAATACTAGCCCAACTCGAGTTGGGCTAGTATTGGAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009265.2-102s1c1
Sequence:CCGGCCACAGTTGCATGAGCAACAACTCGAGTTGTTGCTCATGCAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009265.2-155s1c1
Sequence:CCGGGCCATGTGTCTCACAAGTCAACTCGAGTTGACTTGTGAGACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009265.3-473s21c1
Sequence:CCGGCCCTCAACTGTCACTCCAATACTCGAGTATTGGAGTGACAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009265.3-167s21c1
Sequence:CCGGCAAGTCAAGACACCCTGTGACCTCGAGGTCACAGGGTGTCTTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009265.3-181s21c1
Sequence:CCGGCTGTGACACCAAGGTTCCTGACTCGAGTCAGGAACCTTGGTGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009265.3-494s21c1
Sequence:CCGGCTAGCCCAACAGAAGACAAAGCTCGAGCTTTGTCTTCTGTTGGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009265.3-591s21c1
Sequence:CCGGGAATATACTATGCCCTAATATCTCGAGATATTAGGGCATAGTATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009265
VALIDATED
SPRR1B MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 1B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009265.2-571s1c1
Sequence:CCGGGCCTCAATTTGCATTCTGTTTCTCGAGAAACAGAATGCAAATTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009265.2-474s1c1
Sequence:CCGGCCCTCAACTGTCACTCCAATACTCGAGTATTGGAGTGACAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009265.2-483s1c1
Sequence:CCGGGTCACTCCAATACTAGCCCAACTCGAGTTGGGCTAGTATTGGAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009265.2-102s1c1
Sequence:CCGGCCACAGTTGCATGAGCAACAACTCGAGTTGTTGCTCATGCAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009265.2-155s1c1
Sequence:CCGGGCCATGTGTCTCACAAGTCAACTCGAGTTGACTTGTGAGACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009265.3-473s21c1
Sequence:CCGGCCCTCAACTGTCACTCCAATACTCGAGTATTGGAGTGACAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009265.3-167s21c1
Sequence:CCGGCAAGTCAAGACACCCTGTGACCTCGAGGTCACAGGGTGTCTTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009265.3-181s21c1
Sequence:CCGGCTGTGACACCAAGGTTCCTGACTCGAGTCAGGAACCTTGGTGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009265.3-494s21c1
Sequence:CCGGCTAGCCCAACAGAAGACAAAGCTCGAGCTTTGTCTTCTGTTGGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009265.3-591s21c1
Sequence:CCGGGAATATACTATGCCCTAATATCTCGAGATATTAGGGCATAGTATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009265
VALIDATED
SPRR1B MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 1B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009265.2-571s1c1
Sequence:CCGGGCCTCAATTTGCATTCTGTTTCTCGAGAAACAGAATGCAAATTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009265.2-474s1c1
Sequence:CCGGCCCTCAACTGTCACTCCAATACTCGAGTATTGGAGTGACAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009265.2-483s1c1
Sequence:CCGGGTCACTCCAATACTAGCCCAACTCGAGTTGGGCTAGTATTGGAGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009265.2-102s1c1
Sequence:CCGGCCACAGTTGCATGAGCAACAACTCGAGTTGTTGCTCATGCAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009265.2-155s1c1
Sequence:CCGGGCCATGTGTCTCACAAGTCAACTCGAGTTGACTTGTGAGACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009265.3-473s21c1
Sequence:CCGGCCCTCAACTGTCACTCCAATACTCGAGTATTGGAGTGACAGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009265.3-167s21c1
Sequence:CCGGCAAGTCAAGACACCCTGTGACCTCGAGGTCACAGGGTGTCTTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009265.3-181s21c1
Sequence:CCGGCTGTGACACCAAGGTTCCTGACTCGAGTCAGGAACCTTGGTGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009265.3-494s21c1
Sequence:CCGGCTAGCCCAACAGAAGACAAAGCTCGAGCTTTGTCTTCTGTTGGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009265.3-591s21c1
Sequence:CCGGGAATATACTATGCCCTAATATCTCGAGATATTAGGGCATAGTATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003125
SPRR1B MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 1B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003125.1-385s1c1
Sequence:CCGGCCTATCCCATTCTGTGTATGACTCGAGTCATACACAGAATGGGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003125.2-448s21c1
Sequence:CCGGAGAATGTGCTATGAAGCTTTCCTCGAGGAAAGCTTCATAGCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003125.2-471s21c1
Sequence:CCGGTCCTACACACTCTGAGTCTCTCTCGAGAGAGACTCAGAGTGTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003125.2-274s21c1
Sequence:CCGGTGAGCCCTGCCCTTCAATAGTCTCGAGACTATTGAAGGGCAGGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003125.2-406s21c1
Sequence:CCGGGTCCCATTTGCCTTGCAATTACTCGAGTAATTGCAAGGCAAATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003125.2-384s21c1
Sequence:CCGGCCCTATCCCATTCTGCGTATGCTCGAGCATACGCAGAATGGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003125
SPRR1B MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 1B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003125.1-385s1c1
Sequence:CCGGCCTATCCCATTCTGTGTATGACTCGAGTCATACACAGAATGGGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003125.2-448s21c1
Sequence:CCGGAGAATGTGCTATGAAGCTTTCCTCGAGGAAAGCTTCATAGCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003125.2-471s21c1
Sequence:CCGGTCCTACACACTCTGAGTCTCTCTCGAGAGAGACTCAGAGTGTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003125.2-274s21c1
Sequence:CCGGTGAGCCCTGCCCTTCAATAGTCTCGAGACTATTGAAGGGCAGGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003125.2-406s21c1
Sequence:CCGGGTCCCATTTGCCTTGCAATTACTCGAGTAATTGCAAGGCAAATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003125.2-384s21c1
Sequence:CCGGCCCTATCCCATTCTGCGTATGCTCGAGCATACGCAGAATGGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003125
SPRR1B MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 1B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003125.1-385s1c1
Sequence:CCGGCCTATCCCATTCTGTGTATGACTCGAGTCATACACAGAATGGGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003125.2-448s21c1
Sequence:CCGGAGAATGTGCTATGAAGCTTTCCTCGAGGAAAGCTTCATAGCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003125.2-471s21c1
Sequence:CCGGTCCTACACACTCTGAGTCTCTCTCGAGAGAGACTCAGAGTGTGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003125.2-274s21c1
Sequence:CCGGTGAGCCCTGCCCTTCAATAGTCTCGAGACTATTGAAGGGCAGGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003125.2-406s21c1
Sequence:CCGGGTCCCATTTGCCTTGCAATTACTCGAGTAATTGCAAGGCAAATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003125.2-384s21c1
Sequence:CCGGCCCTATCCCATTCTGCGTATGCTCGAGCATACGCAGAATGGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks