EMAIL THIS PAGE TO A FRIEND

SPRR2A

small proline-rich protein 2A

UniProtKB ID: P35326, B2R4T3, D3DV35, Q5T529
Gene ID:
sheep(780523) small proline-rich protein 2A
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005988 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005988 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212880 predicted 295
2 SASI_Hs01_00212881 predicted 302
3 SASI_Hs01_00212882 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005988
SPRR2A MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 2A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-206s1c1
Sequence:CCGGCAGTGCCAGCAGAAATATCCTCTCGAGAGGATATTTCTGCTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005988.2-203s1c1
Sequence:CCGGCAGCAGTGCCAGCAGAAATATCTCGAGATATTTCTGCTGGCACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005988.2-255s1c1
Sequence:CCGGCAAAGTATCCACCGAAGAGCACTCGAGTGCTCTTCGGTGGATACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-253s1c1
Sequence:CCGGGTCAAAGTATCCACCGAAGAGCTCGAGCTCTTCGGTGGATACTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-250s1c1
Sequence:CCGGCCAGTCAAAGTATCCACCGAACTCGAGTTCGGTGGATACTTTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005988.2-346s1c1
Sequence:CCGGCACCTTCATCTTCTCATCAAACTCGAGTTTGATGAGAAGATGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005988.2-345s1c1
Sequence:CCGGCCACCTTCATCTTCTCATCAACTCGAGTTGATGAGAAGATGAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005988.2-215s1c1
Sequence:CCGGCAGAAATATCCTCCTGTGACACTCGAGTGTCACAGGAGGATATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-214s1c1
Sequence:CCGGGCAGAAATATCCTCCTGTGACCTCGAGGTCACAGGAGGATATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-251s1c1
Sequence:CCGGCAGTCAAAGTATCCACCGAAGCTCGAGCTTCGGTGGATACTTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-212s1c1
Sequence:CCGGCAGCAGAAATATCCTCCTGTGCTCGAGCACAGGAGGATATTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005988
SPRR2A MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 2A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-206s1c1
Sequence:CCGGCAGTGCCAGCAGAAATATCCTCTCGAGAGGATATTTCTGCTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005988.2-203s1c1
Sequence:CCGGCAGCAGTGCCAGCAGAAATATCTCGAGATATTTCTGCTGGCACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005988.2-255s1c1
Sequence:CCGGCAAAGTATCCACCGAAGAGCACTCGAGTGCTCTTCGGTGGATACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-253s1c1
Sequence:CCGGGTCAAAGTATCCACCGAAGAGCTCGAGCTCTTCGGTGGATACTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-250s1c1
Sequence:CCGGCCAGTCAAAGTATCCACCGAACTCGAGTTCGGTGGATACTTTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005988.2-346s1c1
Sequence:CCGGCACCTTCATCTTCTCATCAAACTCGAGTTTGATGAGAAGATGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005988.2-345s1c1
Sequence:CCGGCCACCTTCATCTTCTCATCAACTCGAGTTGATGAGAAGATGAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005988.2-215s1c1
Sequence:CCGGCAGAAATATCCTCCTGTGACACTCGAGTGTCACAGGAGGATATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-214s1c1
Sequence:CCGGGCAGAAATATCCTCCTGTGACCTCGAGGTCACAGGAGGATATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-251s1c1
Sequence:CCGGCAGTCAAAGTATCCACCGAAGCTCGAGCTTCGGTGGATACTTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-212s1c1
Sequence:CCGGCAGCAGAAATATCCTCCTGTGCTCGAGCACAGGAGGATATTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005988
SPRR2A MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 2A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-206s1c1
Sequence:CCGGCAGTGCCAGCAGAAATATCCTCTCGAGAGGATATTTCTGCTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005988.2-203s1c1
Sequence:CCGGCAGCAGTGCCAGCAGAAATATCTCGAGATATTTCTGCTGGCACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005988.2-255s1c1
Sequence:CCGGCAAAGTATCCACCGAAGAGCACTCGAGTGCTCTTCGGTGGATACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-253s1c1
Sequence:CCGGGTCAAAGTATCCACCGAAGAGCTCGAGCTCTTCGGTGGATACTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-250s1c1
Sequence:CCGGCCAGTCAAAGTATCCACCGAACTCGAGTTCGGTGGATACTTTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005988.2-346s1c1
Sequence:CCGGCACCTTCATCTTCTCATCAAACTCGAGTTTGATGAGAAGATGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005988.2-345s1c1
Sequence:CCGGCCACCTTCATCTTCTCATCAACTCGAGTTGATGAGAAGATGAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005988.2-215s1c1
Sequence:CCGGCAGAAATATCCTCCTGTGACACTCGAGTGTCACAGGAGGATATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-214s1c1
Sequence:CCGGGCAGAAATATCCTCCTGTGACCTCGAGGTCACAGGAGGATATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-251s1c1
Sequence:CCGGCAGTCAAAGTATCCACCGAAGCTCGAGCTTCGGTGGATACTTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005988.2-212s1c1
Sequence:CCGGCAGCAGAAATATCCTCCTGTGCTCGAGCACAGGAGGATATTTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks