EMAIL THIS PAGE TO A FRIEND

SPRR2B

small proline-rich protein 2B

UniProtKB ID: P35325, Q5T528
Gene ID:
Mouse(20756) small proline-rich protein 2B
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001017418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017418 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017418 Rosetta Predictions human pricing
NM_011469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115288 predicted 353
2 SASI_Hs01_00115289 predicted 352
3 SASI_Hs01_00115290 predicted 353
4 SASI_Hs01_00115291 predicted 377
5 SASI_Hs01_00115292 predicted 356
6 SASI_Hs01_00115293 predicted 483
7 SASI_Hs01_00115294 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132341 predicted 391
2 SASI_Mm01_00132342 predicted 393
3 SASI_Mm01_00132344 predicted 359
4 SASI_Mm01_00132345 predicted 384
5 SASI_Mm01_00132346 predicted 431
6 SASI_Mm01_00132347 predicted 365
7 SASI_Mm02_00320733 predicted 449
8 SASI_Mm01_00132348 predicted 365
9 SASI_Mm01_00132343 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011469
SPRR2B MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 2B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011469.3-359s21c1
Sequence:CCGGAGGGTTTCCCAGTCATCAGGACTCGAGTCCTGATGACTGGGAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011469.3-345s21c1
Sequence:CCGGCCCAAGAATAAATGAGGGTTTCTCGAGAAACCCTCATTTATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011469.3-177s21c1
Sequence:CCGGCCAGTATGCTGTGAGCCTTGTCTCGAGACAAGGCTCACAGCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011469.3-372s21c1
Sequence:CCGGCATCAGGACTGGGAAGTAAGACTCGAGTCTTACTTCCCAGTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011469.3-405s21c1
Sequence:CCGGACTGGCTCACCAACTCCATAGCTCGAGCTATGGAGTTGGTGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011469
SPRR2B MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 2B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011469.3-359s21c1
Sequence:CCGGAGGGTTTCCCAGTCATCAGGACTCGAGTCCTGATGACTGGGAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011469.3-345s21c1
Sequence:CCGGCCCAAGAATAAATGAGGGTTTCTCGAGAAACCCTCATTTATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011469.3-177s21c1
Sequence:CCGGCCAGTATGCTGTGAGCCTTGTCTCGAGACAAGGCTCACAGCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011469.3-372s21c1
Sequence:CCGGCATCAGGACTGGGAAGTAAGACTCGAGTCTTACTTCCCAGTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011469.3-405s21c1
Sequence:CCGGACTGGCTCACCAACTCCATAGCTCGAGCTATGGAGTTGGTGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011469
SPRR2B MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 2B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011469.3-359s21c1
Sequence:CCGGAGGGTTTCCCAGTCATCAGGACTCGAGTCCTGATGACTGGGAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011469.3-345s21c1
Sequence:CCGGCCCAAGAATAAATGAGGGTTTCTCGAGAAACCCTCATTTATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011469.3-177s21c1
Sequence:CCGGCCAGTATGCTGTGAGCCTTGTCTCGAGACAAGGCTCACAGCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011469.3-372s21c1
Sequence:CCGGCATCAGGACTGGGAAGTAAGACTCGAGTCTTACTTCCCAGTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011469.3-405s21c1
Sequence:CCGGACTGGCTCACCAACTCCATAGCTCGAGCTATGGAGTTGGTGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017418
SPRR2B MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 2B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017418.1-355s21c1
Sequence:CCGGATCTTCTCATCAAAGCTTATCCTCGAGGATAAGCTTTGATGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017418.1-245s21c1
Sequence:CCGGCACCCTGCCAGCCAAAGTATCCTCGAGGATACTTTGGCTGGCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017418.1-279s21c1
Sequence:CCGGGTAACAGCTTCAGGATTCATCCTCGAGGATGAATCCTGAAGCTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017418.1-222s21c1
Sequence:CCGGATATCCTCCTGTGACACCTTCCTCGAGGAAGGTGTCACAGGAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017418.1-263s21c1
Sequence:CCGGATCCACCGAAGAGCAAGTAACCTCGAGGTTACTTGCTCTTCGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017418.1-507s1c1
Sequence:CCGGCTTTGTCAGTTCCCAGAGCTTCTCGAGAAGCTCTGGGAACTGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157177    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017418.1-490s1c1
Sequence:CCGGGAGCAAAGGAACCTTGGCTTTCTCGAGAAAGCCAAGGTTCCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017418.1-484s1c1
Sequence:CCGGGAGACTGAGCAAAGGAACCTTCTCGAGAAGGTTCCTTTGCTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017418
SPRR2B MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 2B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017418.1-355s21c1
Sequence:CCGGATCTTCTCATCAAAGCTTATCCTCGAGGATAAGCTTTGATGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017418.1-245s21c1
Sequence:CCGGCACCCTGCCAGCCAAAGTATCCTCGAGGATACTTTGGCTGGCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017418.1-279s21c1
Sequence:CCGGGTAACAGCTTCAGGATTCATCCTCGAGGATGAATCCTGAAGCTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017418.1-222s21c1
Sequence:CCGGATATCCTCCTGTGACACCTTCCTCGAGGAAGGTGTCACAGGAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017418.1-263s21c1
Sequence:CCGGATCCACCGAAGAGCAAGTAACCTCGAGGTTACTTGCTCTTCGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017418.1-507s1c1
Sequence:CCGGCTTTGTCAGTTCCCAGAGCTTCTCGAGAAGCTCTGGGAACTGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157177    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017418.1-490s1c1
Sequence:CCGGGAGCAAAGGAACCTTGGCTTTCTCGAGAAAGCCAAGGTTCCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017418.1-484s1c1
Sequence:CCGGGAGACTGAGCAAAGGAACCTTCTCGAGAAGGTTCCTTTGCTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017418
SPRR2B MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 2B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017418.1-355s21c1
Sequence:CCGGATCTTCTCATCAAAGCTTATCCTCGAGGATAAGCTTTGATGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017418.1-245s21c1
Sequence:CCGGCACCCTGCCAGCCAAAGTATCCTCGAGGATACTTTGGCTGGCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017418.1-279s21c1
Sequence:CCGGGTAACAGCTTCAGGATTCATCCTCGAGGATGAATCCTGAAGCTGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017418.1-222s21c1
Sequence:CCGGATATCCTCCTGTGACACCTTCCTCGAGGAAGGTGTCACAGGAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017418.1-263s21c1
Sequence:CCGGATCCACCGAAGAGCAAGTAACCTCGAGGTTACTTGCTCTTCGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017418.1-507s1c1
Sequence:CCGGCTTTGTCAGTTCCCAGAGCTTCTCGAGAAGCTCTGGGAACTGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157177    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017418.1-490s1c1
Sequence:CCGGGAGCAAAGGAACCTTGGCTTTCTCGAGAAAGCCAAGGTTCCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017418.1-484s1c1
Sequence:CCGGGAGACTGAGCAAAGGAACCTTCTCGAGAAGGTTCCTTTGCTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks