EMAIL THIS PAGE TO A FRIEND

SPRR2D

small proline-rich protein 2D

UniProtKB ID: P22532, A4QN03, A8K5K2, D3DV33, Q5T523, Q96RM3
Gene ID:
Mouse(20758) small proline-rich protein 2D
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006945 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006945 Rosetta Predictions human pricing
NM_011470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174076 predicted 411
2 SASI_Hs01_00174077 predicted 337
3 SASI_Hs01_00174078 predicted 356
4 SASI_Hs02_00342660 predicted 405
5 SASI_Hs02_00342661 predicted 414
6 SASI_Hs02_00342662 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151169 predicted 363
2 SASI_Mm01_00151170 predicted 368
3 SASI_Mm02_00320734 predicted 312
4 SASI_Mm01_00151171 predicted 389
5 SASI_Mm01_00151172 predicted 398
6 SASI_Mm01_00151173 predicted 420
7 SASI_Mm01_00151174 predicted 391
8 SASI_Mm01_00151175 predicted 366
9 SASI_Mm01_00151176 predicted 396
10 SASI_Mm01_00151177 predicted 362
11 SASI_Mm01_00151178 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006945
SPRR2D MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 2D
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157883    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006945.3-498s1c1
Sequence:CCGGCAGGGAGCTTCTTTCTCCTTACTCGAGTAAGGAGAAAGAAGCTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154965    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006945.3-415s1c1
Sequence:CCGGGAGCATGAGAGGATAAGGATACTCGAGTATCCTTATCCTCTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154823    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006945.3-534s1c1
Sequence:CCGGGTGATGATCTGTGACAGCAAACTCGAGTTTGCTGTCACAGATCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006945.4-277s21c1
Sequence:CCGGTAACAGCTTCAGGATTCATCACTCGAGTGATGAATCCTGAAGCTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006945.4-168s21c1
Sequence:CCGGCCCATCACCAAAGTGTCCACACTCGAGTGTGGACACTTTGGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006945.4-470s21c1
Sequence:CCGGCTGTCCAGGTGGAGCTAAGAACTCGAGTTCTTAGCTCCACCTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006945.4-260s21c1
Sequence:CCGGGTCCACCCAAGAGCAAGTAACCTCGAGGTTACTTGCTCTTGGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006945.4-203s21c1
Sequence:CCGGAGCAGTGCCAGCAGAAATATCCTCGAGGATATTTCTGCTGGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006945
SPRR2D MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 2D
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157883    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006945.3-498s1c1
Sequence:CCGGCAGGGAGCTTCTTTCTCCTTACTCGAGTAAGGAGAAAGAAGCTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154965    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006945.3-415s1c1
Sequence:CCGGGAGCATGAGAGGATAAGGATACTCGAGTATCCTTATCCTCTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154823    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006945.3-534s1c1
Sequence:CCGGGTGATGATCTGTGACAGCAAACTCGAGTTTGCTGTCACAGATCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006945.4-277s21c1
Sequence:CCGGTAACAGCTTCAGGATTCATCACTCGAGTGATGAATCCTGAAGCTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006945.4-168s21c1
Sequence:CCGGCCCATCACCAAAGTGTCCACACTCGAGTGTGGACACTTTGGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006945.4-470s21c1
Sequence:CCGGCTGTCCAGGTGGAGCTAAGAACTCGAGTTCTTAGCTCCACCTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006945.4-260s21c1
Sequence:CCGGGTCCACCCAAGAGCAAGTAACCTCGAGGTTACTTGCTCTTGGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006945.4-203s21c1
Sequence:CCGGAGCAGTGCCAGCAGAAATATCCTCGAGGATATTTCTGCTGGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006945
SPRR2D MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 2D
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157883    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006945.3-498s1c1
Sequence:CCGGCAGGGAGCTTCTTTCTCCTTACTCGAGTAAGGAGAAAGAAGCTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154965    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006945.3-415s1c1
Sequence:CCGGGAGCATGAGAGGATAAGGATACTCGAGTATCCTTATCCTCTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154823    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006945.3-534s1c1
Sequence:CCGGGTGATGATCTGTGACAGCAAACTCGAGTTTGCTGTCACAGATCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006945.4-277s21c1
Sequence:CCGGTAACAGCTTCAGGATTCATCACTCGAGTGATGAATCCTGAAGCTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006945.4-168s21c1
Sequence:CCGGCCCATCACCAAAGTGTCCACACTCGAGTGTGGACACTTTGGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006945.4-470s21c1
Sequence:CCGGCTGTCCAGGTGGAGCTAAGAACTCGAGTTCTTAGCTCCACCTGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006945.4-260s21c1
Sequence:CCGGGTCCACCCAAGAGCAAGTAACCTCGAGGTTACTTGCTCTTGGGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006945.4-203s21c1
Sequence:CCGGAGCAGTGCCAGCAGAAATATCCTCGAGGATATTTCTGCTGGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011470
SPRR2D MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 2D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-368s21c1
Sequence:CCGGCACCCATCTTCCTTCCAAATCCTCGAGGATTTGGAAGGAAGATGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-403s21c1
Sequence:CCGGGAGGAATCTCCTTCACCTTTCCTCGAGGAAAGGTGAAGGAGATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-447s21c1
Sequence:CCGGCCCTAACAGGGAAGATGTTTCCTCGAGGAAACATCTTCCCTGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-307s21c1
Sequence:CCGGTCAGCAGTCATCAGGACAAACCTCGAGGTTTGTCCTGATGACTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-497s21c1
Sequence:CCGGGGGCTGCAGAGAATGATCTGTCTCGAGACAGATCATTCTCTGCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011470
SPRR2D MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 2D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-368s21c1
Sequence:CCGGCACCCATCTTCCTTCCAAATCCTCGAGGATTTGGAAGGAAGATGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-403s21c1
Sequence:CCGGGAGGAATCTCCTTCACCTTTCCTCGAGGAAAGGTGAAGGAGATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-447s21c1
Sequence:CCGGCCCTAACAGGGAAGATGTTTCCTCGAGGAAACATCTTCCCTGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-307s21c1
Sequence:CCGGTCAGCAGTCATCAGGACAAACCTCGAGGTTTGTCCTGATGACTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-497s21c1
Sequence:CCGGGGGCTGCAGAGAATGATCTGTCTCGAGACAGATCATTCTCTGCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011470
SPRR2D MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 2D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-368s21c1
Sequence:CCGGCACCCATCTTCCTTCCAAATCCTCGAGGATTTGGAAGGAAGATGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-403s21c1
Sequence:CCGGGAGGAATCTCCTTCACCTTTCCTCGAGGAAAGGTGAAGGAGATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-447s21c1
Sequence:CCGGCCCTAACAGGGAAGATGTTTCCTCGAGGAAACATCTTCCCTGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-307s21c1
Sequence:CCGGTCAGCAGTCATCAGGACAAACCTCGAGGTTTGTCCTGATGACTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011470.1-497s21c1
Sequence:CCGGGGGCTGCAGAGAATGATCTGTCTCGAGACAGATCATTCTCTGCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks