EMAIL THIS PAGE TO A FRIEND

SPRR2E

small proline-rich protein 2E

UniProtKB ID: P22531, Q5T9T4, Q96RM2
Gene ID:
Mouse(20759) small proline-rich protein 2E
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024209 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024209 Rosetta Predictions human pricing
NM_011471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063150 predicted 380
2 SASI_Hs01_00063151 predicted 323
3 SASI_Hs01_00063152 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196725 predicted 275
2 SASI_Mm01_00196726 predicted 403
3 SASI_Mm01_00196727 predicted 409
4 SASI_Mm01_00196728 predicted 372
5 SASI_Mm01_00196729 predicted 374
6 SASI_Mm01_00196730 predicted 293
7 SASI_Mm01_00196731 predicted 383
8 SASI_Mm01_00196732 predicted 400
9 SASI_Mm01_00196733 predicted 276
10 SASI_Mm01_00196734 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024209
SPRR2E MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 2E
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182952    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024209.1-385s1c1
Sequence:CCGGCAGTTAGCTTCTTTCCTCTTACTCGAGTAAGAGGAAAGAAGCTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180537    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024209.1-369s1c1
Sequence:CCGGGCCTACCATGGATACACAGTTCTCGAGAACTGTGTATCCATGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024209.1-391s1c1
Sequence:CCGGGCTTCTTTCCTCTTAGCCAGTCTCGAGACTGGCTAAGAGGAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181195    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024209.1-448s1c1
Sequence:CCGGCCTTTCTGAGGCTGCCATATTCTCGAGAATATGGCAGCCTCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024209
SPRR2E MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 2E
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182952    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024209.1-385s1c1
Sequence:CCGGCAGTTAGCTTCTTTCCTCTTACTCGAGTAAGAGGAAAGAAGCTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180537    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024209.1-369s1c1
Sequence:CCGGGCCTACCATGGATACACAGTTCTCGAGAACTGTGTATCCATGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024209.1-391s1c1
Sequence:CCGGGCTTCTTTCCTCTTAGCCAGTCTCGAGACTGGCTAAGAGGAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181195    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024209.1-448s1c1
Sequence:CCGGCCTTTCTGAGGCTGCCATATTCTCGAGAATATGGCAGCCTCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024209
SPRR2E MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 2E
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182952    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024209.1-385s1c1
Sequence:CCGGCAGTTAGCTTCTTTCCTCTTACTCGAGTAAGAGGAAAGAAGCTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180537    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024209.1-369s1c1
Sequence:CCGGGCCTACCATGGATACACAGTTCTCGAGAACTGTGTATCCATGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180401    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024209.1-391s1c1
Sequence:CCGGGCTTCTTTCCTCTTAGCCAGTCTCGAGACTGGCTAAGAGGAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181195    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024209.1-448s1c1
Sequence:CCGGCCTTTCTGAGGCTGCCATATTCTCGAGAATATGGCAGCCTCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011471
SPRR2E MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 2E
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011471.2-407s1c1
Sequence:CCGGGTCACTCCCATTTGCCTGTAACTCGAGTTACAGGCAAATGGGAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011471.2-488s1c1
Sequence:CCGGGCTGATTATATGTTCTCAAGTCTCGAGACTTGAGAACATATAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011471.2-328s1c1
Sequence:CCGGGAGAATCTATCTCATGTACTTCTCGAGAAGTACATGAGATAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011471.2-325s1c1
Sequence:CCGGGAAGAGAATCTATCTCATGTACTCGAGTACATGAGATAGATTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011471
SPRR2E MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 2E
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011471.2-407s1c1
Sequence:CCGGGTCACTCCCATTTGCCTGTAACTCGAGTTACAGGCAAATGGGAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011471.2-488s1c1
Sequence:CCGGGCTGATTATATGTTCTCAAGTCTCGAGACTTGAGAACATATAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011471.2-328s1c1
Sequence:CCGGGAGAATCTATCTCATGTACTTCTCGAGAAGTACATGAGATAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011471.2-325s1c1
Sequence:CCGGGAAGAGAATCTATCTCATGTACTCGAGTACATGAGATAGATTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011471
SPRR2E MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 2E
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011471.2-407s1c1
Sequence:CCGGGTCACTCCCATTTGCCTGTAACTCGAGTTACAGGCAAATGGGAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011471.2-488s1c1
Sequence:CCGGGCTGATTATATGTTCTCAAGTCTCGAGACTTGAGAACATATAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011471.2-328s1c1
Sequence:CCGGGAGAATCTATCTCATGTACTTCTCGAGAAGTACATGAGATAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011471.2-325s1c1
Sequence:CCGGGAAGAGAATCTATCTCATGTACTCGAGTACATGAGATAGATTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks