EMAIL THIS PAGE TO A FRIEND

SPRR2F

small proline-rich protein 2F

UniProtKB ID: Q96RM1, Q5T9T3
Gene ID:
Mouse(20760) small proline-rich protein 2F
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1402928 Monoclonal Anti-SPRR2F antibody produced in mouse clone 5A9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014450 Rosetta Predictions human pricing
NM_011472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064183 predicted 409
2 SASI_Hs01_00064184 predicted 401
3 SASI_Hs01_00064185 predicted 402
4 SASI_Hs01_00064186 predicted 395
5 SASI_Hs01_00064187 predicted 394
6 SASI_Hs01_00064188 predicted 409
7 SASI_Hs01_00064189 predicted 405
8 SASI_Hs01_00064190 predicted 168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062115 predicted 372
2 SASI_Mm01_00062116 predicted 325
3 SASI_Mm01_00062117 predicted 349
4 SASI_Mm01_00062118 predicted 356
5 SASI_Mm01_00062119 predicted 322
6 SASI_Mm01_00062120 predicted 342
7 SASI_Mm01_00062121 predicted 337
8 SASI_Mm01_00062122 predicted 362
9 SASI_Mm01_00062123 predicted 274
10 SASI_Mm01_00062124 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014450
SPRR2F MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 2F
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203973    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-349s1c1
Sequence:CCGGGCATCTTCTCATCAAAGCCATCTCGAGATGGCTTTGATGAGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014450.1-172s1c1
Sequence:CCGGCATCAAAGTGTCCACAGTCCTCTCGAGAGGACTGTGGACACTTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014450.1-169s1c1
Sequence:CCGGCACCATCAAAGTGTCCACAGTCTCGAGACTGTGGACACTTTGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-292s1c1
Sequence:CCGGCATCAGGAGCATGAAAGGATACTCGAGTATCCTTTCATGCTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-343s1c1
Sequence:CCGGCCACCTGCATCTTCTCATCAACTCGAGTTGATGAGAAGATGCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-387s1c1
Sequence:CCGGGCTTCTTTCCTCTTAGCCTGTCTCGAGACAGGCTAAGAGGAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-300s1c1
Sequence:CCGGGCATGAAAGGATAAGGATAATCTCGAGATTATCCTTATCCTTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014450
SPRR2F MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 2F
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203973    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-349s1c1
Sequence:CCGGGCATCTTCTCATCAAAGCCATCTCGAGATGGCTTTGATGAGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014450.1-172s1c1
Sequence:CCGGCATCAAAGTGTCCACAGTCCTCTCGAGAGGACTGTGGACACTTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014450.1-169s1c1
Sequence:CCGGCACCATCAAAGTGTCCACAGTCTCGAGACTGTGGACACTTTGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-292s1c1
Sequence:CCGGCATCAGGAGCATGAAAGGATACTCGAGTATCCTTTCATGCTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-343s1c1
Sequence:CCGGCCACCTGCATCTTCTCATCAACTCGAGTTGATGAGAAGATGCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-387s1c1
Sequence:CCGGGCTTCTTTCCTCTTAGCCTGTCTCGAGACAGGCTAAGAGGAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-300s1c1
Sequence:CCGGGCATGAAAGGATAAGGATAATCTCGAGATTATCCTTATCCTTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014450
SPRR2F MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 2F
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203973    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-349s1c1
Sequence:CCGGGCATCTTCTCATCAAAGCCATCTCGAGATGGCTTTGATGAGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014450.1-172s1c1
Sequence:CCGGCATCAAAGTGTCCACAGTCCTCTCGAGAGGACTGTGGACACTTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014450.1-169s1c1
Sequence:CCGGCACCATCAAAGTGTCCACAGTCTCGAGACTGTGGACACTTTGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-292s1c1
Sequence:CCGGCATCAGGAGCATGAAAGGATACTCGAGTATCCTTTCATGCTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-343s1c1
Sequence:CCGGCCACCTGCATCTTCTCATCAACTCGAGTTGATGAGAAGATGCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-387s1c1
Sequence:CCGGGCTTCTTTCCTCTTAGCCTGTCTCGAGACAGGCTAAGAGGAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014450.1-300s1c1
Sequence:CCGGGCATGAAAGGATAAGGATAATCTCGAGATTATCCTTATCCTTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011472
SPRR2F MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 2F
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011472.2-371s1c1
Sequence:CCGGCCTCCAAAGTCTGACATGGATCTCGAGATCCATGTCAGACTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011472.2-214s1c1
Sequence:CCGGCTCCCTCATTCCAGCAGAAATCTCGAGATTTCTGCTGGAATGAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179528    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011472.2-383s1c1
Sequence:CCGGGACATGGATGCAGAAGAATTTCTCGAGAAATTCTTCTGCATCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011472.2-429s21c1
Sequence:CCGGTCTCAGTGATGACCTCTAATACTCGAGTATTAGAGGTCATCACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011472.2-346s21c1
Sequence:CCGGCATTCCATAGCAACACCTTATCTCGAGATAAGGTGTTGCTATGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011472.2-378s21c1
Sequence:CCGGAGTCTGACATGGATGCAGAAGCTCGAGCTTCTGCATCCATGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011472.2-404s21c1
Sequence:CCGGTCTCTACCCTTCACCTACTTCCTCGAGGAAGTAGGTGAAGGGTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011472.2-289s21c1
Sequence:CCGGAGTGAAGTCTTCAGCAGTCTTCTCGAGAAGACTGCTGAAGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011472
SPRR2F MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 2F
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011472.2-371s1c1
Sequence:CCGGCCTCCAAAGTCTGACATGGATCTCGAGATCCATGTCAGACTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011472.2-214s1c1
Sequence:CCGGCTCCCTCATTCCAGCAGAAATCTCGAGATTTCTGCTGGAATGAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179528    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011472.2-383s1c1
Sequence:CCGGGACATGGATGCAGAAGAATTTCTCGAGAAATTCTTCTGCATCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011472.2-429s21c1
Sequence:CCGGTCTCAGTGATGACCTCTAATACTCGAGTATTAGAGGTCATCACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011472.2-346s21c1
Sequence:CCGGCATTCCATAGCAACACCTTATCTCGAGATAAGGTGTTGCTATGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011472.2-378s21c1
Sequence:CCGGAGTCTGACATGGATGCAGAAGCTCGAGCTTCTGCATCCATGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011472.2-404s21c1
Sequence:CCGGTCTCTACCCTTCACCTACTTCCTCGAGGAAGTAGGTGAAGGGTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011472.2-289s21c1
Sequence:CCGGAGTGAAGTCTTCAGCAGTCTTCTCGAGAAGACTGCTGAAGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011472
SPRR2F MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 2F
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011472.2-371s1c1
Sequence:CCGGCCTCCAAAGTCTGACATGGATCTCGAGATCCATGTCAGACTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011472.2-214s1c1
Sequence:CCGGCTCCCTCATTCCAGCAGAAATCTCGAGATTTCTGCTGGAATGAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179528    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011472.2-383s1c1
Sequence:CCGGGACATGGATGCAGAAGAATTTCTCGAGAAATTCTTCTGCATCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011472.2-429s21c1
Sequence:CCGGTCTCAGTGATGACCTCTAATACTCGAGTATTAGAGGTCATCACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011472.2-346s21c1
Sequence:CCGGCATTCCATAGCAACACCTTATCTCGAGATAAGGTGTTGCTATGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011472.2-378s21c1
Sequence:CCGGAGTCTGACATGGATGCAGAAGCTCGAGCTTCTGCATCCATGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011472.2-404s21c1
Sequence:CCGGTCTCTACCCTTCACCTACTTCCTCGAGGAAGTAGGTGAAGGGTAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011472.2-289s21c1
Sequence:CCGGAGTGAAGTCTTCAGCAGTCTTCTCGAGAAGACTGCTGAAGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks