EMAIL THIS PAGE TO A FRIEND

SPRR2G

small proline-rich protein 2G

UniProtKB ID: Q9BYE4
Gene ID:
Mouse(20761) small proline-rich protein 2G
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224211 MISSION® esiRNA esiRNA targeting human SPRR2G human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014291 Rosetta Predictions human pricing
NM_011473 Rosetta Predictions mouse pricing
NR_003548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103861 predicted 214
2 SASI_Hs01_00103862 predicted 319
3 SASI_Hs01_00103863 predicted 319
4 SASI_Hs01_00103864 predicted 305
5 SASI_Hs01_00103865 predicted 241
6 SASI_Hs01_00103866 predicted 285
7 SASI_Hs01_00103867 predicted 204
8 SASI_Hs01_00103869 predicted 252
9 SASI_Hs01_00103870 predicted 215
10 SASI_Hs02_00306529 predicted 287
11 SASI_Hs01_00103868 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088206 predicted 209
2 SASI_Mm01_00088207 predicted 217
3 SASI_Mm01_00088208 predicted 510
4 SASI_Mm01_00088209 predicted 429
5 SASI_Mm01_00088210 predicted 440
6 SASI_Mm01_00088211 predicted 381
7 SASI_Mm01_00088212 predicted 329
8 SASI_Mm01_00088213 predicted 335
9 SASI_Mm01_00088214 predicted 351
10 SASI_Mm01_00088215 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353463 predicted 204
2 SASI_Mm02_00353464 predicted 206
3 SASI_Mm02_00353465 predicted 513
4 SASI_Mm02_00353466 predicted 426
5 SASI_Mm02_00353467 predicted 606
6 SASI_Mm02_00353468 predicted 433
7 SASI_Mm02_00353469 predicted 374
8 SASI_Mm02_00353470 predicted 323
9 SASI_Mm02_00353471 predicted 352
10 SASI_Mm02_00353472 predicted 600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014291
SPRR2G MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 2G
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014291.3-262s21c1
Sequence:CCGGACCTCCACCATGCCAGGATAACTCGAGTTATCCTGGCATGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001014291.3-378s21c1
Sequence:CCGGAGATCCAGTGGCTCTTCTTACCTCGAGGTAAGAAGAGCCACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014291.3-284s21c1
Sequence:CCGGTGCCCTCCTGTGCAACCATACCTCGAGGTATGGTTGCACAGGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014291.3-238s21c1
Sequence:CCGGTCCTTGTCCACCTGAGCATTGCTCGAGCAATGCTCAGGTGGACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014291.3-334s21c1
Sequence:CCGGGAGCAAGTAACATCACTAGAACTCGAGTTCTAGTGATGTTACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014291.1-704s1c1
Sequence:CCGGCAACAAGATCCAGTGGCTCTTCTCGAGAAGAGCCACTGGATCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014291.1-653s1c1
Sequence:CCGGGTATCCACCCAAGAGCAAGTACTCGAGTACTTGCTCTTGGGTGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014291.1-650s1c1
Sequence:CCGGGAAGTATCCACCCAAGAGCAACTCGAGTTGCTCTTGGGTGGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014291
SPRR2G MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 2G
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014291.3-262s21c1
Sequence:CCGGACCTCCACCATGCCAGGATAACTCGAGTTATCCTGGCATGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001014291.3-378s21c1
Sequence:CCGGAGATCCAGTGGCTCTTCTTACCTCGAGGTAAGAAGAGCCACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014291.3-284s21c1
Sequence:CCGGTGCCCTCCTGTGCAACCATACCTCGAGGTATGGTTGCACAGGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014291.3-238s21c1
Sequence:CCGGTCCTTGTCCACCTGAGCATTGCTCGAGCAATGCTCAGGTGGACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014291.3-334s21c1
Sequence:CCGGGAGCAAGTAACATCACTAGAACTCGAGTTCTAGTGATGTTACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014291.1-704s1c1
Sequence:CCGGCAACAAGATCCAGTGGCTCTTCTCGAGAAGAGCCACTGGATCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014291.1-653s1c1
Sequence:CCGGGTATCCACCCAAGAGCAAGTACTCGAGTACTTGCTCTTGGGTGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014291.1-650s1c1
Sequence:CCGGGAAGTATCCACCCAAGAGCAACTCGAGTTGCTCTTGGGTGGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014291
SPRR2G MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 2G
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014291.3-262s21c1
Sequence:CCGGACCTCCACCATGCCAGGATAACTCGAGTTATCCTGGCATGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001014291.3-378s21c1
Sequence:CCGGAGATCCAGTGGCTCTTCTTACCTCGAGGTAAGAAGAGCCACTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014291.3-284s21c1
Sequence:CCGGTGCCCTCCTGTGCAACCATACCTCGAGGTATGGTTGCACAGGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014291.3-238s21c1
Sequence:CCGGTCCTTGTCCACCTGAGCATTGCTCGAGCAATGCTCAGGTGGACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014291.3-334s21c1
Sequence:CCGGGAGCAAGTAACATCACTAGAACTCGAGTTCTAGTGATGTTACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014291.1-704s1c1
Sequence:CCGGCAACAAGATCCAGTGGCTCTTCTCGAGAAGAGCCACTGGATCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014291.1-653s1c1
Sequence:CCGGGTATCCACCCAAGAGCAAGTACTCGAGTACTTGCTCTTGGGTGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014291.1-650s1c1
Sequence:CCGGGAAGTATCCACCCAAGAGCAACTCGAGTTGCTCTTGGGTGGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011473
SPRR2G MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 2G
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011473.2-176s1c1
Sequence:CCGGCCAAAGTGTCCTGAACCTTGTCTCGAGACAAGGTTCAGGACACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011473.2-354s1c1
Sequence:CCGGCCAATACTTCTATCTTCCATTCTCGAGAATGGAAGATAGAAGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011473.2-389s1c1
Sequence:CCGGGATGCAAATGAATCTTCTCTACTCGAGTAGAGAAGATTCATTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011473.2-410s1c1
Sequence:CCGGCCCTTCATCTTTCAAATGCCTCTCGAGAGGCATTTGAAAGATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011473.2-213s1c1
Sequence:CCGGCTTCTCCATGCCAGCAGAAATCTCGAGATTTCTGCTGGCATGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011473
SPRR2G MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 2G
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011473.2-176s1c1
Sequence:CCGGCCAAAGTGTCCTGAACCTTGTCTCGAGACAAGGTTCAGGACACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011473.2-354s1c1
Sequence:CCGGCCAATACTTCTATCTTCCATTCTCGAGAATGGAAGATAGAAGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011473.2-389s1c1
Sequence:CCGGGATGCAAATGAATCTTCTCTACTCGAGTAGAGAAGATTCATTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011473.2-410s1c1
Sequence:CCGGCCCTTCATCTTTCAAATGCCTCTCGAGAGGCATTTGAAAGATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011473.2-213s1c1
Sequence:CCGGCTTCTCCATGCCAGCAGAAATCTCGAGATTTCTGCTGGCATGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011473
SPRR2G MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 2G
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011473.2-176s1c1
Sequence:CCGGCCAAAGTGTCCTGAACCTTGTCTCGAGACAAGGTTCAGGACACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011473.2-354s1c1
Sequence:CCGGCCAATACTTCTATCTTCCATTCTCGAGAATGGAAGATAGAAGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011473.2-389s1c1
Sequence:CCGGGATGCAAATGAATCTTCTCTACTCGAGTAGAGAAGATTCATTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011473.2-410s1c1
Sequence:CCGGCCCTTCATCTTTCAAATGCCTCTCGAGAGGCATTTGAAAGATGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011473.2-213s1c1
Sequence:CCGGCTTCTCCATGCCAGCAGAAATCTCGAGATTTCTGCTGGCATGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks