EMAIL THIS PAGE TO A FRIEND

SPRR3

small proline-rich protein 3

Gene ID:
Mouse(20766) small proline-rich protein 3
Rat(310575) small proline-rich protein 3
cow(783113) small proline-rich protein 3
sheep(101121394) small proline-rich protein 3
domestic guinea pig(100732161) small proline-rich protein 3
naked mole-rat(101698108) small proline-rich protein 3
Domestic Rabbit(100009219) small proline-rich protein 3
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005416 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080691 MISSION® esiRNA esiRNA human SPRR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097589 Rosetta Predictions human pricing
NM_005416 Rosetta Predictions human pricing
NM_001107686 Rosetta Predictions rat pricing
NM_011478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318240 predicted 501
2 SASI_Hs02_00318241 predicted 570
3 SASI_Hs02_00318242 predicted 414
4 SASI_Hs02_00318243 predicted 510
5 SASI_Hs02_00318244 predicted 662
6 SASI_Hs02_00318245 predicted 559
7 SASI_Hs02_00318246 predicted 372
8 SASI_Hs02_00318247 predicted 578
9 SASI_Hs02_00318248 predicted 461
10 SASI_Hs02_00318249 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150656 predicted 594
2 SASI_Hs01_00150657 predicted 649
3 SASI_Hs01_00150658 predicted 498
4 SASI_Hs01_00150660 predicted 602
5 SASI_Hs01_00150661 predicted 747
6 SASI_Hs01_00150662 predicted 643
7 SASI_Hs02_00339550 predicted 455
8 SASI_Hs02_00339551 predicted 661
9 SASI_Hs02_00339552 predicted 546
10 SASI_Hs02_00339553 predicted 508
11 SASI_Hs01_00150655 predicted 241
12 SASI_Hs01_00150659 predicted 283
13 SASI_Hs01_00150663 predicted 317
14 SASI_Hs01_00150664 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231275 predicted 319
2 SASI_Rn02_00231276 predicted 448
3 SASI_Rn02_00231277 predicted 250
4 SASI_Rn02_00231278 predicted 445
5 SASI_Rn02_00231279 predicted 258
6 SASI_Rn02_00231280 predicted 350
7 SASI_Rn02_00231281 predicted 317
8 SASI_Rn02_00231282 predicted 196
9 SASI_Rn02_00231283 predicted 518
10 SASI_Rn02_00231284 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199727 predicted 257
2 SASI_Mm01_00199728 predicted 231
3 SASI_Mm01_00199730 predicted 376
4 SASI_Mm01_00199731 predicted 481
5 SASI_Mm01_00199732 predicted 197
6 SASI_Mm01_00199733 predicted 371
7 SASI_Mm01_00199734 predicted 206
8 SASI_Mm01_00199735 predicted 306
9 SASI_Mm02_00320747 predicted 207
10 SASI_Mm01_00199729 predicted 283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011478
SPRR3 MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-310s1c1
Sequence:CCGGGAGCCAGATTATACTACAATTCTCGAGAATTGTAGTATAATCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-506s1c1
Sequence:CCGGCAAGCTCAGAACCATGCTCTACTCGAGTAGAGCATGGTTCTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-404s1c1
Sequence:CCGGCAGAGCCAGATTATACCACAACTCGAGTTGTGGTATAATCTGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-260s1c1
Sequence:CCGGCTGAGCCAGATTATACCACAACTCGAGTTGTGGTATAATCTGGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-49s1c1
Sequence:CCGGGAACAGCATCAAGTGAAGCAACTCGAGTTGCTTCACTTGATGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011478.1-587s21c1
Sequence:CCGGATCAGGGCTACACCAAGATACCTCGAGGTATCTTGGTGTAGCCCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011478.1-481s21c1
Sequence:CCGGCCCAGTCCTTCCAGTACTTCTCTCGAGAGAAGTACTGGAAGGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011478.1-214s21c1
Sequence:CCGGGAGCCAGATTATACTACGATGCTCGAGCATCGTAGTATAATCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011478
SPRR3 MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-310s1c1
Sequence:CCGGGAGCCAGATTATACTACAATTCTCGAGAATTGTAGTATAATCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-506s1c1
Sequence:CCGGCAAGCTCAGAACCATGCTCTACTCGAGTAGAGCATGGTTCTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-404s1c1
Sequence:CCGGCAGAGCCAGATTATACCACAACTCGAGTTGTGGTATAATCTGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-260s1c1
Sequence:CCGGCTGAGCCAGATTATACCACAACTCGAGTTGTGGTATAATCTGGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-49s1c1
Sequence:CCGGGAACAGCATCAAGTGAAGCAACTCGAGTTGCTTCACTTGATGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011478.1-587s21c1
Sequence:CCGGATCAGGGCTACACCAAGATACCTCGAGGTATCTTGGTGTAGCCCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011478.1-481s21c1
Sequence:CCGGCCCAGTCCTTCCAGTACTTCTCTCGAGAGAAGTACTGGAAGGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011478.1-214s21c1
Sequence:CCGGGAGCCAGATTATACTACGATGCTCGAGCATCGTAGTATAATCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011478
SPRR3 MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-310s1c1
Sequence:CCGGGAGCCAGATTATACTACAATTCTCGAGAATTGTAGTATAATCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-506s1c1
Sequence:CCGGCAAGCTCAGAACCATGCTCTACTCGAGTAGAGCATGGTTCTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-404s1c1
Sequence:CCGGCAGAGCCAGATTATACCACAACTCGAGTTGTGGTATAATCTGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-260s1c1
Sequence:CCGGCTGAGCCAGATTATACCACAACTCGAGTTGTGGTATAATCTGGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011478.1-49s1c1
Sequence:CCGGGAACAGCATCAAGTGAAGCAACTCGAGTTGCTTCACTTGATGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011478.1-587s21c1
Sequence:CCGGATCAGGGCTACACCAAGATACCTCGAGGTATCTTGGTGTAGCCCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011478.1-481s21c1
Sequence:CCGGCCCAGTCCTTCCAGTACTTCTCTCGAGAGAAGTACTGGAAGGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011478.1-214s21c1
Sequence:CCGGGAGCCAGATTATACTACGATGCTCGAGCATCGTAGTATAATCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005416
SPRR3 MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005416.1-226s1c1
Sequence:CCGGGCCTCCACCTCAGGAAATATTCTCGAGAATATTTCCTGAGGTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005416.1-637s1c1
Sequence:CCGGGCAGAAGACCAAGCAGAAGTACTCGAGTACTTCTGCTTGGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005416.1-276s1c1
Sequence:CCGGCAAAGGTTCCACAACCTGGAACTCGAGTTCCAGGTTGTGGAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005416.1-287s1c1
Sequence:CCGGCAACCTGGAAACACAAAGATTCTCGAGAATCTTTGTGTTTCCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005416.1-776s1c1
Sequence:CCGGGCCATAGTCTCTCTCTTATTTCTCGAGAAATAAGAGAGAGACTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005416.1-716s1c1
Sequence:CCGGCCATCTGTTTCTGTGTCTTAACTCGAGTTAAGACACAGAAACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005416.1-290s1c1
Sequence:CCGGCCTGGAAACACAAAGATTCCACTCGAGTGGAATCTTTGTGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005416.1-554s1c1
Sequence:CCGGCAAGGATACACCAAAGTTCCTCTCGAGAGGAACTTTGGTGTATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005416.1-503s1c1
Sequence:CCGGGACCAAGGCTTCATCAAGTTTCTCGAGAAACTTGATGAAGCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005416
SPRR3 MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005416.1-226s1c1
Sequence:CCGGGCCTCCACCTCAGGAAATATTCTCGAGAATATTTCCTGAGGTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005416.1-637s1c1
Sequence:CCGGGCAGAAGACCAAGCAGAAGTACTCGAGTACTTCTGCTTGGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005416.1-276s1c1
Sequence:CCGGCAAAGGTTCCACAACCTGGAACTCGAGTTCCAGGTTGTGGAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005416.1-287s1c1
Sequence:CCGGCAACCTGGAAACACAAAGATTCTCGAGAATCTTTGTGTTTCCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005416.1-776s1c1
Sequence:CCGGGCCATAGTCTCTCTCTTATTTCTCGAGAAATAAGAGAGAGACTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005416.1-716s1c1
Sequence:CCGGCCATCTGTTTCTGTGTCTTAACTCGAGTTAAGACACAGAAACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005416.1-290s1c1
Sequence:CCGGCCTGGAAACACAAAGATTCCACTCGAGTGGAATCTTTGTGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005416.1-554s1c1
Sequence:CCGGCAAGGATACACCAAAGTTCCTCTCGAGAGGAACTTTGGTGTATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005416.1-503s1c1
Sequence:CCGGGACCAAGGCTTCATCAAGTTTCTCGAGAAACTTGATGAAGCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005416
SPRR3 MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005416.1-226s1c1
Sequence:CCGGGCCTCCACCTCAGGAAATATTCTCGAGAATATTTCCTGAGGTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005416.1-637s1c1
Sequence:CCGGGCAGAAGACCAAGCAGAAGTACTCGAGTACTTCTGCTTGGTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005416.1-276s1c1
Sequence:CCGGCAAAGGTTCCACAACCTGGAACTCGAGTTCCAGGTTGTGGAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005416.1-287s1c1
Sequence:CCGGCAACCTGGAAACACAAAGATTCTCGAGAATCTTTGTGTTTCCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005416.1-776s1c1
Sequence:CCGGGCCATAGTCTCTCTCTTATTTCTCGAGAAATAAGAGAGAGACTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005416.1-716s1c1
Sequence:CCGGCCATCTGTTTCTGTGTCTTAACTCGAGTTAAGACACAGAAACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005416.1-290s1c1
Sequence:CCGGCCTGGAAACACAAAGATTCCACTCGAGTGGAATCTTTGTGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005416.1-554s1c1
Sequence:CCGGCAAGGATACACCAAAGTTCCTCTCGAGAGGAACTTTGGTGTATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005416.1-503s1c1
Sequence:CCGGGACCAAGGCTTCATCAAGTTTCTCGAGAAACTTGATGAAGCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks