EMAIL THIS PAGE TO A FRIEND

SPRR4

small proline-rich protein 4

UniProtKB ID: Q96PI1, Q2M1Y7, Q5T522
Gene ID:
Mouse(229562) small proline-rich protein 4
Rat(100361607) small proline-rich protein 4
domestic cat(101087336) small proline-rich protein 4
domestic guinea pig(100720573) small proline-rich protein 4
cow(788280) small proline-rich protein 4
sheep(101101851) small proline-rich protein 4
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173080 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142561 MISSION® esiRNA esiRNA human SPRR4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173080 Rosetta Predictions human pricing
NM_173070 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094119 predicted 524
2 SASI_Hs01_00094120 predicted 270
3 SASI_Hs01_00094121 predicted 296
4 SASI_Hs01_00094122 predicted 563
5 SASI_Hs01_00094123 predicted 563
6 SASI_Hs01_00094124 predicted 300
7 SASI_Hs02_00368075 predicted 476
8 SASI_Hs01_00094126 predicted 524
9 SASI_Hs01_00094127 predicted 653
10 SASI_Hs01_00094128 predicted 474
11 SASI_Hs01_00094125 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139047 predicted 182
2 SASI_Mm01_00139048 predicted 74
3 SASI_Mm01_00139050 predicted 153
4 SASI_Mm01_00139051 predicted 120
5 SASI_Mm01_00139052 predicted 149
6 SASI_Mm01_00139054 predicted 24
7 SASI_Mm01_00139055 predicted 169
8 SASI_Mm01_00139056 predicted 160
9 SASI_Mm02_00345144 predicted 155
10 SASI_Mm02_00345145 predicted 192
11 SASI_Mm01_00139049 predicted 124
12 SASI_Mm01_00139053 predicted 69
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173080
SPRR4 MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173080.1-227s21c1
Sequence:CCGGCACCGAAAGGCACCATCATTCCTCGAGGAATGATGGTGCCTTTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173080.1-432s21c1
Sequence:CCGGGGAAGCATTGTAAGGATTTCTCTCGAGAGAAATCCTTACAATGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173080.1-479s1c1
Sequence:CCGGCCACCTTGGCTTCTTCTATATCTCGAGATATAGAAGAAGCCAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173080.1-314s1c1
Sequence:CCGGGATATTACCATCATCCACCATCTCGAGATGGTGGATGATGGTAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173080.1-153s1c1
Sequence:CCGGCCCTGTTAAATGTCAAGAGACCTCGAGGTCTCTTGACATTTAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173080.1-154s1c1
Sequence:CCGGCCTGTTAAATGTCAAGAGACACTCGAGTGTCTCTTGACATTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173080.1-581s1c1
Sequence:CCGGCCATTTCCCAAAGTGAGGAAACTCGAGTTTCCTCACTTTGGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173080
SPRR4 MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173080.1-227s21c1
Sequence:CCGGCACCGAAAGGCACCATCATTCCTCGAGGAATGATGGTGCCTTTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173080.1-432s21c1
Sequence:CCGGGGAAGCATTGTAAGGATTTCTCTCGAGAGAAATCCTTACAATGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173080.1-479s1c1
Sequence:CCGGCCACCTTGGCTTCTTCTATATCTCGAGATATAGAAGAAGCCAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173080.1-314s1c1
Sequence:CCGGGATATTACCATCATCCACCATCTCGAGATGGTGGATGATGGTAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173080.1-153s1c1
Sequence:CCGGCCCTGTTAAATGTCAAGAGACCTCGAGGTCTCTTGACATTTAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173080.1-154s1c1
Sequence:CCGGCCTGTTAAATGTCAAGAGACACTCGAGTGTCTCTTGACATTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173080.1-581s1c1
Sequence:CCGGCCATTTCCCAAAGTGAGGAAACTCGAGTTTCCTCACTTTGGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173080
SPRR4 MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173080.1-227s21c1
Sequence:CCGGCACCGAAAGGCACCATCATTCCTCGAGGAATGATGGTGCCTTTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173080.1-432s21c1
Sequence:CCGGGGAAGCATTGTAAGGATTTCTCTCGAGAGAAATCCTTACAATGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173080.1-479s1c1
Sequence:CCGGCCACCTTGGCTTCTTCTATATCTCGAGATATAGAAGAAGCCAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173080.1-314s1c1
Sequence:CCGGGATATTACCATCATCCACCATCTCGAGATGGTGGATGATGGTAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173080.1-153s1c1
Sequence:CCGGCCCTGTTAAATGTCAAGAGACCTCGAGGTCTCTTGACATTTAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173080.1-154s1c1
Sequence:CCGGCCTGTTAAATGTCAAGAGACACTCGAGTGTCTCTTGACATTTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173080.1-581s1c1
Sequence:CCGGCCATTTCCCAAAGTGAGGAAACTCGAGTTTCCTCACTTTGGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173070
SPRR4 MISSION shRNA Bacterial Glycerol Stock
small proline-rich protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-26s21c1
Sequence:CCGGAGCAACAGTGCACACCACAAGCTCGAGCTTGTGGTGTGCACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-127s21c1
Sequence:CCGGCCATGTGTTCCTCAGGCCAAACTCGAGTTTGGCCTGAGGAACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-202s21c1
Sequence:CCGGCAGCAAGACCCTAAGTGTAAGCTCGAGCTTACACTTAGGGTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-74s21c1
Sequence:CCGGGTCAGCCACCTCCTACCAAATCTCGAGATTTGGTAGGAGGTGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-168s21c1
Sequence:CCGGCACAACTAACCCAGCTCAAGACTCGAGTCTTGAGCTGGGTTAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173070
SPRR4 MISSION shRNA shRNA Plasmid DNA
small proline-rich protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-26s21c1
Sequence:CCGGAGCAACAGTGCACACCACAAGCTCGAGCTTGTGGTGTGCACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-127s21c1
Sequence:CCGGCCATGTGTTCCTCAGGCCAAACTCGAGTTTGGCCTGAGGAACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-202s21c1
Sequence:CCGGCAGCAAGACCCTAAGTGTAAGCTCGAGCTTACACTTAGGGTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-74s21c1
Sequence:CCGGGTCAGCCACCTCCTACCAAATCTCGAGATTTGGTAGGAGGTGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-168s21c1
Sequence:CCGGCACAACTAACCCAGCTCAAGACTCGAGTCTTGAGCTGGGTTAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173070
SPRR4 MISSION shRNA Lentiviral Transduction Particles
small proline-rich protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-26s21c1
Sequence:CCGGAGCAACAGTGCACACCACAAGCTCGAGCTTGTGGTGTGCACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-127s21c1
Sequence:CCGGCCATGTGTTCCTCAGGCCAAACTCGAGTTTGGCCTGAGGAACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-202s21c1
Sequence:CCGGCAGCAAGACCCTAAGTGTAAGCTCGAGCTTACACTTAGGGTCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-74s21c1
Sequence:CCGGGTCAGCCACCTCCTACCAAATCTCGAGATTTGGTAGGAGGTGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173070.1-168s21c1
Sequence:CCGGCACAACTAACCCAGCTCAAGACTCGAGTCTTGAGCTGGGTTAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks