EMAIL THIS PAGE TO A FRIEND

SPRTN

SprT-like N-terminal domain

Synonyms: C1orf124 DDDL1880 DVC1 PRO4323 Spartan dJ876B10.3
Gene ID:
Mouse(244666) SprT-like N-terminal domain
Rat(292101) SprT-like N-terminal domain
domestic cat(101090214) SprT-like N-terminal domain
dog(488972) SprT-like N-terminal domain
cow(534918) SprT-like N-terminal domain
sheep(101111686) SprT-like N-terminal domain
domestic guinea pig(100726031) SprT-like N-terminal domain
naked mole-rat(101710243) SprT-like N-terminal domain
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032018 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001111141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001111141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001111141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010984 Rosetta Predictions human pricing
NM_032018 Rosetta Predictions human pricing
NM_001106199 Rosetta Predictions rat pricing
NM_001111141 Rosetta Predictions mouse pricing
XM_001480333 Rosetta Predictions mouse pricing
XM_902816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194383 predicted 821
2 SASI_Hs02_00305954 predicted 884
3 SASI_Hs01_00194384 predicted 871
4 SASI_Hs02_00305955 predicted 911
5 SASI_Hs01_00194386 predicted 786
6 SASI_Hs02_00305956 predicted 871
7 SASI_Hs01_00194387 predicted 742
8 SASI_Hs01_00194388 predicted 666
9 SASI_Hs01_00194391 predicted 568
10 SASI_Hs01_00194392 predicted 875
11 SASI_Hs01_00194385 predicted 788
12 SASI_Hs01_00194389 predicted 704
13 SASI_Hs01_00194390 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212870 predicted 1423
2 SASI_Hs01_00212871 predicted 884
3 SASI_Hs01_00212873 predicted 1445
4 SASI_Hs01_00212874 predicted 787
5 SASI_Hs01_00212875 predicted 1985
6 SASI_Hs01_00212876 predicted 1637
7 SASI_Hs01_00212877 predicted 1427
8 SASI_Hs01_00212879 predicted 849
9 SASI_Hs02_00359198 predicted 1922
10 SASI_Hs02_00359199 predicted 1565
11 SASI_Hs01_00212872 predicted 1436
12 SASI_Hs01_00212878 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216608 predicted 307
2 SASI_Rn02_00216609 predicted 625
3 SASI_Rn02_00216610 predicted 410
4 SASI_Rn02_00216611 predicted 632
5 SASI_Rn02_00216612 predicted 767
6 SASI_Rn02_00216613 predicted 1049
7 SASI_Rn02_00216614 predicted 784
8 SASI_Rn02_00216615 predicted 981
9 SASI_Rn02_00216616 predicted 1151
10 SASI_Rn02_00216617 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306512 predicted 664
2 SASI_Mm02_00306513 predicted 669
3 SASI_Mm02_00306514 predicted 1086
4 SASI_Mm02_00306515 predicted 619
5 SASI_Mm02_00306516 predicted 918
6 SASI_Mm02_00306517 predicted 1039
7 SASI_Mm02_00306518 predicted 1114
8 SASI_Mm02_00306519 predicted 1833
9 SASI_Mm02_00306520 predicted 573
10 SASI_Mm02_00306521 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00416768 predicted 668
2 SASI_Mm02_00416769 predicted 671
3 SASI_Mm02_00416770 predicted 1093
4 SASI_Mm02_00416771 predicted 617
5 SASI_Mm02_00416772 predicted 910
6 SASI_Mm02_00416773 predicted 1043
7 SASI_Mm02_00416774 predicted 1110
8 SASI_Mm02_00416775 predicted 1827
9 SASI_Mm02_00416776 predicted 568
10 SASI_Mm02_00416777 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204891 predicted 1308
2 SASI_Mm01_00204892 predicted 940
3 SASI_Mm01_00204893 predicted 834
4 SASI_Mm01_00204894 predicted 1028
5 SASI_Mm01_00204895 predicted 1320
6 SASI_Mm01_00204896 predicted 1200
7 SASI_Mm01_00204897 predicted 1141
8 SASI_Mm01_00204898 predicted 921
9 SASI_Mm01_00204899 predicted 939
10 SASI_Mm01_00204900 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032018
VALIDATED
SPRTN MISSION shRNA Bacterial Glycerol Stock
SprT-like N-terminal domain
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073308    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-1720s1c1
Sequence:CCGGGCTACATTCACTCTTGCCTTACTCGAGTAAGGCAAGAGTGAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073311    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-1372s1c1
Sequence:CCGGGTACAACCACAGCTCAGAATTCTCGAGAATTCTGAGCTGTGGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073312    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-878s1c1
Sequence:CCGGGATCACTTCACATGCCATTAACTCGAGTTAATGGCATGTGAAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073309    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-765s1c1
Sequence:CCGGGCCGCAGAGAATAAAGATAAACTCGAGTTTATCTTTATTCTCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073310    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-605s1c1
Sequence:CCGGCTATGTCAAACGAGCTACTAACTCGAGTTAGTAGCTCGTTTGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032018.4-1835s21c1
Sequence:CCGGGTTCTGGAGTCTCAGATTAATCTCGAGATTAATCTGAGACTCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032018.4-876s21c1
Sequence:CCGGGCCTGACTGGAGCCAATATAACTCGAGTTATATTGGCTCCAGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032018.4-1439s21c1
Sequence:CCGGTACTTTCCTAGAGTATCATTTCTCGAGAAATGATACTCTAGGAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032018.4-782s21c1
Sequence:CCGGGAAATGATACATGCCTATTTACTCGAGTAAATAGGCATGTATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032018
VALIDATED
SPRTN MISSION shRNA shRNA Plasmid DNA
SprT-like N-terminal domain
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073308    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-1720s1c1
Sequence:CCGGGCTACATTCACTCTTGCCTTACTCGAGTAAGGCAAGAGTGAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073311    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-1372s1c1
Sequence:CCGGGTACAACCACAGCTCAGAATTCTCGAGAATTCTGAGCTGTGGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073312    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-878s1c1
Sequence:CCGGGATCACTTCACATGCCATTAACTCGAGTTAATGGCATGTGAAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073309    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-765s1c1
Sequence:CCGGGCCGCAGAGAATAAAGATAAACTCGAGTTTATCTTTATTCTCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073310    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-605s1c1
Sequence:CCGGCTATGTCAAACGAGCTACTAACTCGAGTTAGTAGCTCGTTTGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032018.4-1835s21c1
Sequence:CCGGGTTCTGGAGTCTCAGATTAATCTCGAGATTAATCTGAGACTCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032018.4-876s21c1
Sequence:CCGGGCCTGACTGGAGCCAATATAACTCGAGTTATATTGGCTCCAGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032018.4-1439s21c1
Sequence:CCGGTACTTTCCTAGAGTATCATTTCTCGAGAAATGATACTCTAGGAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032018.4-782s21c1
Sequence:CCGGGAAATGATACATGCCTATTTACTCGAGTAAATAGGCATGTATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032018
VALIDATED
SPRTN MISSION shRNA Lentiviral Transduction Particles
SprT-like N-terminal domain
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073308    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-1720s1c1
Sequence:CCGGGCTACATTCACTCTTGCCTTACTCGAGTAAGGCAAGAGTGAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073311    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-1372s1c1
Sequence:CCGGGTACAACCACAGCTCAGAATTCTCGAGAATTCTGAGCTGTGGTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073312    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-878s1c1
Sequence:CCGGGATCACTTCACATGCCATTAACTCGAGTTAATGGCATGTGAAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073309    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-765s1c1
Sequence:CCGGGCCGCAGAGAATAAAGATAAACTCGAGTTTATCTTTATTCTCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073310    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032018.2-605s1c1
Sequence:CCGGCTATGTCAAACGAGCTACTAACTCGAGTTAGTAGCTCGTTTGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032018.4-1835s21c1
Sequence:CCGGGTTCTGGAGTCTCAGATTAATCTCGAGATTAATCTGAGACTCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032018.4-876s21c1
Sequence:CCGGGCCTGACTGGAGCCAATATAACTCGAGTTATATTGGCTCCAGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032018.4-1439s21c1
Sequence:CCGGTACTTTCCTAGAGTATCATTTCTCGAGAAATGATACTCTAGGAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032018.4-782s21c1
Sequence:CCGGGAAATGATACATGCCTATTTACTCGAGTAAATAGGCATGTATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111141
SPRTN MISSION shRNA Bacterial Glycerol Stock
SprT-like N-terminal domain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111141.1-972s21c1
Sequence:CCGGGCATCGGCAGTGGAGAATAAACTCGAGTTTATTCTCCACTGCCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111141.1-1854s21c1
Sequence:CCGGTGACTGCGCCAGCGCTTTATACTCGAGTATAAAGCGCTGGCGCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111141.1-1545s21c1
Sequence:CCGGAGGACTGCTTTGGATACTATCCTCGAGGATAGTATCCAAAGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111141.1-612s21c1
Sequence:CCGGATGATACATGCCTACTTATTTCTCGAGAAATAAGTAGGCATGTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111141.1-1466s21c1
Sequence:CCGGTGGGACATCCGCAACCATATCCTCGAGGATATGGTTGCGGATGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111141
SPRTN MISSION shRNA shRNA Plasmid DNA
SprT-like N-terminal domain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111141.1-972s21c1
Sequence:CCGGGCATCGGCAGTGGAGAATAAACTCGAGTTTATTCTCCACTGCCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111141.1-1854s21c1
Sequence:CCGGTGACTGCGCCAGCGCTTTATACTCGAGTATAAAGCGCTGGCGCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111141.1-1545s21c1
Sequence:CCGGAGGACTGCTTTGGATACTATCCTCGAGGATAGTATCCAAAGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111141.1-612s21c1
Sequence:CCGGATGATACATGCCTACTTATTTCTCGAGAAATAAGTAGGCATGTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111141.1-1466s21c1
Sequence:CCGGTGGGACATCCGCAACCATATCCTCGAGGATATGGTTGCGGATGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111141
SPRTN MISSION shRNA Lentiviral Transduction Particles
SprT-like N-terminal domain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111141.1-972s21c1
Sequence:CCGGGCATCGGCAGTGGAGAATAAACTCGAGTTTATTCTCCACTGCCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111141.1-1854s21c1
Sequence:CCGGTGACTGCGCCAGCGCTTTATACTCGAGTATAAAGCGCTGGCGCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111141.1-1545s21c1
Sequence:CCGGAGGACTGCTTTGGATACTATCCTCGAGGATAGTATCCAAAGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111141.1-612s21c1
Sequence:CCGGATGATACATGCCTACTTATTTCTCGAGAAATAAGTAGGCATGTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111141.1-1466s21c1
Sequence:CCGGTGGGACATCCGCAACCATATCCTCGAGGATATGGTTGCGGATGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks