EMAIL THIS PAGE TO A FRIEND

SPRY1

sprouty homolog 1, antagonist of FGF signaling (Drosophila)

Synonyms: hSPRY1
UniProtKB ID: O43609, D3DNX6, Q6PNE0
Gene ID:
Mouse(24063) sprouty homolog 1 (Drosophila)
Rat(294981) sprouty homolog 1, antagonist of FGF signaling (Drosophila)
cow(507095) sprouty homolog 1, antagonist of FGF signaling (Drosophila)
sheep(101102179) sprouty homolog 1, antagonist of FGF signaling (Drosophila)
naked mole-rat(101722459) sprouty homolog 1, antagonist of FGF signaling (Drosophila)
domestic guinea pig(100734287) sprouty homolog 1, antagonist of FGF signaling (Drosophila)
Zebrafish(798229) sprouty homolog 1 (Drosophila)
domestic cat(101086473) sprouty homolog 1, antagonist of FGF signaling (Drosophila)
dog(483838) sprouty homolog 1, antagonist of FGF signaling (Drosophila)
chicken(395583) sprouty homolog 1, antagonist of FGF signaling (Drosophila)
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005841 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011896 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011896 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011896 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005841 Rosetta Predictions human pricing
NM_199327 Rosetta Predictions human pricing
NM_001106427 Rosetta Predictions rat pricing
NM_011896 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043190 predicted 1068
2 SASI_Hs01_00043191 predicted 556
3 SASI_Hs01_00043192 predicted 807
4 SASI_Hs01_00043193 predicted 532
5 SASI_Hs01_00043194 predicted 547
6 SASI_Hs02_00340379 predicted 904
7 SASI_Hs01_00043195 predicted 974
8 SASI_Hs01_00043196 predicted 1041
9 SASI_Hs02_00340380 predicted 827
10 SASI_Hs01_00043197 predicted 959
11 SASI_Hs01_00043189 predicted 961
12 SASI_Hs01_00043198 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228503 predicted 929
2 SASI_Hs01_00228504 predicted 423
3 SASI_Hs01_00228505 predicted 680
4 SASI_Hs01_00228506 predicted 402
5 SASI_Hs01_00228507 predicted 411
6 SASI_Hs02_00372742 predicted 770
7 SASI_Hs01_00228508 predicted 842
8 SASI_Hs01_00228509 predicted 906
9 SASI_Hs02_00372743 predicted 694
10 SASI_Hs01_00228510 predicted 831
11 SASI_Hs01_00228502 predicted 821
12 SASI_Hs01_00228511 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218858 predicted 296
2 SASI_Rn02_00218859 predicted 207
3 SASI_Rn02_00218860 predicted 609
4 SASI_Rn02_00218861 predicted 602
5 SASI_Rn02_00218862 predicted 595
6 SASI_Rn02_00218863 predicted 297
7 SASI_Rn02_00218864 predicted 475
8 SASI_Rn02_00218865 predicted 197
9 SASI_Rn02_00218866 predicted 397
10 SASI_Rn02_00218867 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131609 predicted 1127
2 SASI_Mm01_00131610 predicted 1528
3 SASI_Mm02_00321706 predicted 841
4 SASI_Mm01_00131611 predicted 695
5 SASI_Mm01_00131612 predicted 1463
6 SASI_Mm01_00131613 predicted 1443
7 SASI_Mm01_00131615 predicted 1457
8 SASI_Mm01_00131616 predicted 1015
9 SASI_Mm01_00131618 predicted 1349
10 SASI_Mm02_00321707 predicted 703
11 SASI_Mm01_00131614 predicted 1362
12 SASI_Mm01_00131617 predicted 616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005841
VALIDATED
SPRY1 MISSION shRNA Bacterial Glycerol Stock
sprouty homolog 1, antagonist of FGF signaling (Drosophila)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005841.1-1643s21c1
Sequence:CCGGTACCGTGGGAGCAGGGAAATTCTCGAGAATTTCCCTGCTCCCACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-390s21c1
Sequence:CCGGGCCGTCAGAGATTAGACTATGCTCGAGCATAGTCTAATCTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-417s21c1
Sequence:CCGGAGATTCAGCCTACTGCTATTTCTCGAGAAATAGCAGTAGGCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-1164s21c1
Sequence:CCGGAGCTGTGCAGGAGGTGTTATGCTCGAGCATAACACCTCCTGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005841.1-1508s21c1
Sequence:CCGGGCCATCCACTTGAGGGTATTGCTCGAGCAATACCCTCAAGTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-988s21c1
Sequence:CCGGGTGCTTAGTCAAGGGCATCTTCTCGAGAAGATGCCCTTGACTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-460s21c1
Sequence:CCGGCATAAGAGGCAGCAATGAATACTCGAGTATTCATTGCTGCCTCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005841.1-799s1c1
Sequence:CCGGGCAACTGATTGTGGATGACTTCTCGAGAAGTCATCCACAATCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005841.1-391s1c1
Sequence:CCGGCCGTCAGAGATTAGACTATGACTCGAGTCATAGTCTAATCTCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005841.1-988s1c1
Sequence:CCGGGTGCTTAGTCAAGGGCATCTTCTCGAGAAGATGCCCTTGACTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005841.1-541s1c1
Sequence:CCGGGCATGAAAGGACTCATGAAATCTCGAGATTTCATGAGTCCTTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005841.1-1080s1c1
Sequence:CCGGGCTGCTCTAGATACCTGTGTACTCGAGTACACAGGTATCTAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005841
VALIDATED
SPRY1 MISSION shRNA shRNA Plasmid DNA
sprouty homolog 1, antagonist of FGF signaling (Drosophila)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005841.1-1643s21c1
Sequence:CCGGTACCGTGGGAGCAGGGAAATTCTCGAGAATTTCCCTGCTCCCACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-390s21c1
Sequence:CCGGGCCGTCAGAGATTAGACTATGCTCGAGCATAGTCTAATCTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-417s21c1
Sequence:CCGGAGATTCAGCCTACTGCTATTTCTCGAGAAATAGCAGTAGGCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-1164s21c1
Sequence:CCGGAGCTGTGCAGGAGGTGTTATGCTCGAGCATAACACCTCCTGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005841.1-1508s21c1
Sequence:CCGGGCCATCCACTTGAGGGTATTGCTCGAGCAATACCCTCAAGTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-988s21c1
Sequence:CCGGGTGCTTAGTCAAGGGCATCTTCTCGAGAAGATGCCCTTGACTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-460s21c1
Sequence:CCGGCATAAGAGGCAGCAATGAATACTCGAGTATTCATTGCTGCCTCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005841.1-799s1c1
Sequence:CCGGGCAACTGATTGTGGATGACTTCTCGAGAAGTCATCCACAATCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005841.1-391s1c1
Sequence:CCGGCCGTCAGAGATTAGACTATGACTCGAGTCATAGTCTAATCTCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005841.1-988s1c1
Sequence:CCGGGTGCTTAGTCAAGGGCATCTTCTCGAGAAGATGCCCTTGACTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005841.1-541s1c1
Sequence:CCGGGCATGAAAGGACTCATGAAATCTCGAGATTTCATGAGTCCTTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005841.1-1080s1c1
Sequence:CCGGGCTGCTCTAGATACCTGTGTACTCGAGTACACAGGTATCTAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005841
VALIDATED
SPRY1 MISSION shRNA Lentiviral Transduction Particles
sprouty homolog 1, antagonist of FGF signaling (Drosophila)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005841.1-1643s21c1
Sequence:CCGGTACCGTGGGAGCAGGGAAATTCTCGAGAATTTCCCTGCTCCCACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-390s21c1
Sequence:CCGGGCCGTCAGAGATTAGACTATGCTCGAGCATAGTCTAATCTCTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-417s21c1
Sequence:CCGGAGATTCAGCCTACTGCTATTTCTCGAGAAATAGCAGTAGGCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-1164s21c1
Sequence:CCGGAGCTGTGCAGGAGGTGTTATGCTCGAGCATAACACCTCCTGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005841.1-1508s21c1
Sequence:CCGGGCCATCCACTTGAGGGTATTGCTCGAGCAATACCCTCAAGTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-988s21c1
Sequence:CCGGGTGCTTAGTCAAGGGCATCTTCTCGAGAAGATGCCCTTGACTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005841.1-460s21c1
Sequence:CCGGCATAAGAGGCAGCAATGAATACTCGAGTATTCATTGCTGCCTCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005841.1-799s1c1
Sequence:CCGGGCAACTGATTGTGGATGACTTCTCGAGAAGTCATCCACAATCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005841.1-391s1c1
Sequence:CCGGCCGTCAGAGATTAGACTATGACTCGAGTCATAGTCTAATCTCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005841.1-988s1c1
Sequence:CCGGGTGCTTAGTCAAGGGCATCTTCTCGAGAAGATGCCCTTGACTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005841.1-541s1c1
Sequence:CCGGGCATGAAAGGACTCATGAAATCTCGAGATTTCATGAGTCCTTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005841.1-1080s1c1
Sequence:CCGGGCTGCTCTAGATACCTGTGTACTCGAGTACACAGGTATCTAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011896
VALIDATED
SPRY1 MISSION shRNA Bacterial Glycerol Stock
sprouty homolog 1, antagonist of FGF signaling (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011896.2-1194s21c1
Sequence:CCGGGGAGGTTCTTACTCGGATAACCTCGAGGTTATCCGAGTAAGAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011896.2-870s21c1
Sequence:CCGGTCTTCTGAGCAGGGCCTATTACTCGAGTAATAGGCCCTGCTCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011896.2-615s21c1
Sequence:CCGGCTGTCCCTAGACCAGATCAAACTCGAGTTTGATCTGGTCTAGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011896.2-732s21c1
Sequence:CCGGCATGAAATCATACCAGCCAATCTCGAGATTGGCTGGTATGATTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011896.2-1662s21c1
Sequence:CCGGATATACGCATGCCCGGATTTGCTCGAGCAAATCCGGGCATGCGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011896.1-1447s1c1
Sequence:CCGGGCGGAATGTCTAGCTTCCAAACTCGAGTTTGGAAGCTAGACATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011896.1-712s1c1
Sequence:CCGGCATGAAATCATACCAGCCAATCTCGAGATTGGCTGGTATGATTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011896.1-988s1c1
Sequence:CCGGCAGCACAAGTTCATCTGCGAACTCGAGTTCGCAGATGAACTTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011896.1-595s1c1
Sequence:CCGGCTGTCCCTAGACCAGATCAAACTCGAGTTTGATCTGGTCTAGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011896.1-1160s1c1
Sequence:CCGGCCAATGATGATGATGGAGGTTCTCGAGAACCTCCATCATCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011896
VALIDATED
SPRY1 MISSION shRNA shRNA Plasmid DNA
sprouty homolog 1, antagonist of FGF signaling (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011896.2-1194s21c1
Sequence:CCGGGGAGGTTCTTACTCGGATAACCTCGAGGTTATCCGAGTAAGAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011896.2-870s21c1
Sequence:CCGGTCTTCTGAGCAGGGCCTATTACTCGAGTAATAGGCCCTGCTCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011896.2-615s21c1
Sequence:CCGGCTGTCCCTAGACCAGATCAAACTCGAGTTTGATCTGGTCTAGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011896.2-732s21c1
Sequence:CCGGCATGAAATCATACCAGCCAATCTCGAGATTGGCTGGTATGATTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011896.2-1662s21c1
Sequence:CCGGATATACGCATGCCCGGATTTGCTCGAGCAAATCCGGGCATGCGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011896.1-1447s1c1
Sequence:CCGGGCGGAATGTCTAGCTTCCAAACTCGAGTTTGGAAGCTAGACATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011896.1-712s1c1
Sequence:CCGGCATGAAATCATACCAGCCAATCTCGAGATTGGCTGGTATGATTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011896.1-988s1c1
Sequence:CCGGCAGCACAAGTTCATCTGCGAACTCGAGTTCGCAGATGAACTTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011896.1-595s1c1
Sequence:CCGGCTGTCCCTAGACCAGATCAAACTCGAGTTTGATCTGGTCTAGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011896.1-1160s1c1
Sequence:CCGGCCAATGATGATGATGGAGGTTCTCGAGAACCTCCATCATCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011896
VALIDATED
SPRY1 MISSION shRNA Lentiviral Transduction Particles
sprouty homolog 1, antagonist of FGF signaling (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011896.2-1194s21c1
Sequence:CCGGGGAGGTTCTTACTCGGATAACCTCGAGGTTATCCGAGTAAGAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011896.2-870s21c1
Sequence:CCGGTCTTCTGAGCAGGGCCTATTACTCGAGTAATAGGCCCTGCTCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011896.2-615s21c1
Sequence:CCGGCTGTCCCTAGACCAGATCAAACTCGAGTTTGATCTGGTCTAGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011896.2-732s21c1
Sequence:CCGGCATGAAATCATACCAGCCAATCTCGAGATTGGCTGGTATGATTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011896.2-1662s21c1
Sequence:CCGGATATACGCATGCCCGGATTTGCTCGAGCAAATCCGGGCATGCGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011896.1-1447s1c1
Sequence:CCGGGCGGAATGTCTAGCTTCCAAACTCGAGTTTGGAAGCTAGACATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011896.1-712s1c1
Sequence:CCGGCATGAAATCATACCAGCCAATCTCGAGATTGGCTGGTATGATTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011896.1-988s1c1
Sequence:CCGGCAGCACAAGTTCATCTGCGAACTCGAGTTCGCAGATGAACTTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011896.1-595s1c1
Sequence:CCGGCTGTCCCTAGACCAGATCAAACTCGAGTTTGATCTGGTCTAGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011896.1-1160s1c1
Sequence:CCGGCCAATGATGATGATGGAGGTTCTCGAGAACCTCCATCATCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks