EMAIL THIS PAGE TO A FRIEND

SPRY2

sprouty homolog 2 (Drosophila)

Synonyms: hSPRY2
UniProtKB ID: O43597, Q5T6Z7
Gene ID:
Human(10253) Summary: This gene encodes a protein belonging to the sprouty family. The encoded protein contains a carboxyl-terminal cysteine-rich domain essential for the inhibitory activity on receptor tyrosine kinase signaling proteins and is required for growth factor stimulated translocation of the protein to membrane ruffles. In primary dermal endothelial cells this gene is transiently upregulated in response to fibroblast growth factor two. This protein is indirectly involved in the non-cell autonomous inhibitory effect on fibroblast growth factor two signaling. The protein interacts with Cas-Br-M (murine) ectropic retroviral transforming sequence, and can function as a bimodal regulator of epidermal growth factor receptor/mitogen-activated protein kinase signaling. This protein may play a role in alveoli branching during lung development as shown by a similar mouse protein. [provided by RefSeq, Jul 2008]
Mouse(24064) sprouty homolog 2 (Drosophila)
Rat(306141) sprouty homolog 2 (Drosophila)
Zebrafish(335098) sprouty homolog 2
dog(485504) sprouty homolog 2 (Drosophila)
domestic cat(101088453) sprouty homolog 2 (Drosophila)
Horse(100050086) sprouty homolog 2 (Drosophila)
chicken(395584) sprouty homolog 2 (Drosophila)
domestic guinea pig(100729578) sprouty homolog 2 (Drosophila)
naked mole-rat(101706722) sprouty homolog 2 (Drosophila)
cow(539090) sprouty homolog 2 (Drosophila)
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005842 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005842 Rosetta Predictions human pricing
NM_001012046 Rosetta Predictions rat pricing
XM_573835 Rosetta Predictions rat pricing
NM_011897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039541 predicted 1052
2 SASI_Hs01_00039542 predicted 1721
3 SASI_Hs01_00039543 predicted 1575
4 SASI_Hs01_00039544 predicted 1114
5 SASI_Hs01_00039545 predicted 1056
6 SASI_Hs01_00039546 predicted 847
7 SASI_Hs01_00039547 predicted 1010
8 SASI_Hs01_00039548 predicted 1063
9 SASI_Hs01_00039549 predicted 1013
10 SASI_Hs02_00340381 predicted 1085
11 SASI_Hs01_00039550 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067509 predicted 817
2 SASI_Rn01_00067510 predicted 873
3 SASI_Rn01_00067511 predicted 698
4 SASI_Rn01_00067512 predicted 942
5 SASI_Rn01_00067513 predicted 707
6 SASI_Rn01_00067514 predicted 1021
7 SASI_Rn01_00067515 predicted 311
8 SASI_Rn01_00067516 predicted 602
9 SASI_Rn01_00067517 predicted 661
10 SASI_Rn02_00200148 predicted 663
11 SASI_Rn01_00067518 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174252 predicted 824
2 SASI_Rn01_00174253 predicted 874
3 SASI_Rn01_00174254 predicted 705
4 SASI_Rn01_00174255 predicted 948
5 SASI_Rn01_00174256 predicted 718
6 SASI_Rn01_00174257 predicted 1025
7 SASI_Rn01_00174258 predicted 313
8 SASI_Rn01_00174259 predicted 609
9 SASI_Rn01_00174260 predicted 668
10 SASI_Rn01_00174261 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094252 predicted 779
2 SASI_Mm01_00094253 predicted 665
3 SASI_Mm01_00094254 predicted 944
4 SASI_Mm01_00094256 predicted 730
5 SASI_Mm01_00094257 predicted 681
6 SASI_Mm01_00094258 predicted 766
7 SASI_Mm01_00094259 predicted 778
8 SASI_Mm01_00094260 predicted 907
9 SASI_Mm01_00094261 predicted 745
10 SASI_Mm02_00321708 predicted 1011
11 SASI_Mm01_00094255 predicted 1013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005842
SPRY2 MISSION shRNA Bacterial Glycerol Stock
sprouty homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005842.2-837s1c1
Sequence:CCGGGCAACCCAAATCTGAGCTCAACTCGAGTTGAGCTCAGATTTGGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005842.2-1171s1c1
Sequence:CCGGCCTTGTTTATGGTGTTACCTTCTCGAGAAGGTAACACCATAAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005842.2-525s1c1
Sequence:CCGGCATCCGAAACACCAATGAGTACTCGAGTACTCATTGGTGTTTCGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005842.2-1054s1c1
Sequence:CCGGCTCTTCTATCACTGTTCTAATCTCGAGATTAGAACAGTGATAGAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005842.2-1392s1c1
Sequence:CCGGGCAACCAACTAAACAGTTATACTCGAGTATAACTGTTTAGTTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005842.2-1446s21c1
Sequence:CCGGCTTTGCTGTTTGCGGTGAAATCTCGAGATTTCACCGCAAACAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005842.2-1222s21c1
Sequence:CCGGGGGTGTTATGACCGGGTTAACCTCGAGGTTAACCCGGTCATAACACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005842.2-1007s21c1
Sequence:CCGGCCCAGAACGTGATTGACTATGCTCGAGCATAGTCAATCACGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005842.2-811s21c1
Sequence:CCGGCCTGTTGCTGATGGCATAATCCTCGAGGATTATGCCATCAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005842.2-696s21c1
Sequence:CCGGCCCTCTGTCCAGATCCATAAGCTCGAGCTTATGGATCTGGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005842
SPRY2 MISSION shRNA shRNA Plasmid DNA
sprouty homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005842.2-837s1c1
Sequence:CCGGGCAACCCAAATCTGAGCTCAACTCGAGTTGAGCTCAGATTTGGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005842.2-1171s1c1
Sequence:CCGGCCTTGTTTATGGTGTTACCTTCTCGAGAAGGTAACACCATAAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005842.2-525s1c1
Sequence:CCGGCATCCGAAACACCAATGAGTACTCGAGTACTCATTGGTGTTTCGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005842.2-1054s1c1
Sequence:CCGGCTCTTCTATCACTGTTCTAATCTCGAGATTAGAACAGTGATAGAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005842.2-1392s1c1
Sequence:CCGGGCAACCAACTAAACAGTTATACTCGAGTATAACTGTTTAGTTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005842.2-1446s21c1
Sequence:CCGGCTTTGCTGTTTGCGGTGAAATCTCGAGATTTCACCGCAAACAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005842.2-1222s21c1
Sequence:CCGGGGGTGTTATGACCGGGTTAACCTCGAGGTTAACCCGGTCATAACACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005842.2-1007s21c1
Sequence:CCGGCCCAGAACGTGATTGACTATGCTCGAGCATAGTCAATCACGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005842.2-811s21c1
Sequence:CCGGCCTGTTGCTGATGGCATAATCCTCGAGGATTATGCCATCAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005842.2-696s21c1
Sequence:CCGGCCCTCTGTCCAGATCCATAAGCTCGAGCTTATGGATCTGGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005842
SPRY2 MISSION shRNA Lentiviral Transduction Particles
sprouty homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005842.2-837s1c1
Sequence:CCGGGCAACCCAAATCTGAGCTCAACTCGAGTTGAGCTCAGATTTGGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005842.2-1171s1c1
Sequence:CCGGCCTTGTTTATGGTGTTACCTTCTCGAGAAGGTAACACCATAAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005842.2-525s1c1
Sequence:CCGGCATCCGAAACACCAATGAGTACTCGAGTACTCATTGGTGTTTCGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005842.2-1054s1c1
Sequence:CCGGCTCTTCTATCACTGTTCTAATCTCGAGATTAGAACAGTGATAGAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005842.2-1392s1c1
Sequence:CCGGGCAACCAACTAAACAGTTATACTCGAGTATAACTGTTTAGTTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005842.2-1446s21c1
Sequence:CCGGCTTTGCTGTTTGCGGTGAAATCTCGAGATTTCACCGCAAACAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005842.2-1222s21c1
Sequence:CCGGGGGTGTTATGACCGGGTTAACCTCGAGGTTAACCCGGTCATAACACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005842.2-1007s21c1
Sequence:CCGGCCCAGAACGTGATTGACTATGCTCGAGCATAGTCAATCACGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005842.2-811s21c1
Sequence:CCGGCCTGTTGCTGATGGCATAATCCTCGAGGATTATGCCATCAGCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005842.2-696s21c1
Sequence:CCGGCCCTCTGTCCAGATCCATAAGCTCGAGCTTATGGATCTGGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011897
VALIDATED
SPRY2 MISSION shRNA Bacterial Glycerol Stock
sprouty homolog 2 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011897.1-1313s1c1
Sequence:CCGGGCAACCAACTAAACAGTTGTACTCGAGTACAACTGTTTAGTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011897.1-911s1c1
Sequence:CCGGGCCCAGAACGTCATTGACTATCTCGAGATAGTCAATGACGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011897.1-959s1c1
Sequence:CCGGCTCTTCTATCACTGCTCCAATCTCGAGATTGGAGCAGTGATAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011897.1-778s1c1
Sequence:CCGGGCCACTGAGCAAGGATGATTTCTCGAGAAATCATCCTTGCTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011897.1-958s1c1
Sequence:CCGGTCTCTTCTATCACTGCTCCAACTCGAGTTGGAGCAGTGATAGAAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011897.3-775s21c1
Sequence:CCGGGCCACTGAGCAAGGATGATTTCTCGAGAAATCATCCTTGCTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011897.3-1221s21c1
Sequence:CCGGAGCCGACATAGCATTATTAATCTCGAGATTAATAATGCTATGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011897.3-972s21c1
Sequence:CCGGCCAATGACGATGAGGACAATTCTCGAGAATTGTCCTCATCGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011897.3-729s21c1
Sequence:CCGGTAATCCGAGTGCAGCCTAAATCTCGAGATTTAGGCTGCACTCGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011897.3-1640s21c1
Sequence:CCGGCAGAGATAATGTGCTATATTTCTCGAGAAATATAGCACATTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011897
VALIDATED
SPRY2 MISSION shRNA shRNA Plasmid DNA
sprouty homolog 2 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011897.1-1313s1c1
Sequence:CCGGGCAACCAACTAAACAGTTGTACTCGAGTACAACTGTTTAGTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011897.1-911s1c1
Sequence:CCGGGCCCAGAACGTCATTGACTATCTCGAGATAGTCAATGACGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011897.1-959s1c1
Sequence:CCGGCTCTTCTATCACTGCTCCAATCTCGAGATTGGAGCAGTGATAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011897.1-778s1c1
Sequence:CCGGGCCACTGAGCAAGGATGATTTCTCGAGAAATCATCCTTGCTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011897.1-958s1c1
Sequence:CCGGTCTCTTCTATCACTGCTCCAACTCGAGTTGGAGCAGTGATAGAAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011897.3-775s21c1
Sequence:CCGGGCCACTGAGCAAGGATGATTTCTCGAGAAATCATCCTTGCTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011897.3-1221s21c1
Sequence:CCGGAGCCGACATAGCATTATTAATCTCGAGATTAATAATGCTATGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011897.3-972s21c1
Sequence:CCGGCCAATGACGATGAGGACAATTCTCGAGAATTGTCCTCATCGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011897.3-729s21c1
Sequence:CCGGTAATCCGAGTGCAGCCTAAATCTCGAGATTTAGGCTGCACTCGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011897.3-1640s21c1
Sequence:CCGGCAGAGATAATGTGCTATATTTCTCGAGAAATATAGCACATTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011897
VALIDATED
SPRY2 MISSION shRNA Lentiviral Transduction Particles
sprouty homolog 2 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011897.1-1313s1c1
Sequence:CCGGGCAACCAACTAAACAGTTGTACTCGAGTACAACTGTTTAGTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011897.1-911s1c1
Sequence:CCGGGCCCAGAACGTCATTGACTATCTCGAGATAGTCAATGACGTTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011897.1-959s1c1
Sequence:CCGGCTCTTCTATCACTGCTCCAATCTCGAGATTGGAGCAGTGATAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011897.1-778s1c1
Sequence:CCGGGCCACTGAGCAAGGATGATTTCTCGAGAAATCATCCTTGCTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011897.1-958s1c1
Sequence:CCGGTCTCTTCTATCACTGCTCCAACTCGAGTTGGAGCAGTGATAGAAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011897.3-775s21c1
Sequence:CCGGGCCACTGAGCAAGGATGATTTCTCGAGAAATCATCCTTGCTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011897.3-1221s21c1
Sequence:CCGGAGCCGACATAGCATTATTAATCTCGAGATTAATAATGCTATGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011897.3-972s21c1
Sequence:CCGGCCAATGACGATGAGGACAATTCTCGAGAATTGTCCTCATCGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011897.3-729s21c1
Sequence:CCGGTAATCCGAGTGCAGCCTAAATCTCGAGATTTAGGCTGCACTCGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011897.3-1640s21c1
Sequence:CCGGCAGAGATAATGTGCTATATTTCTCGAGAAATATAGCACATTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks