EMAIL THIS PAGE TO A FRIEND

SPRY3

sprouty homolog 3 (Drosophila)

Synonyms: HSPRY3 spry-3
UniProtKB ID: O43610, A8K0H8
Gene ID:
Mouse(236576) sprouty homolog 3 (Drosophila)
Rat(498159) sprouty homolog 3 (Drosophila)
cow(539402) sprouty homolog 3 (Drosophila)
sheep(101106569) sprouty homolog 3 (Drosophila)
naked mole-rat(101701305) sprouty homolog 3 (Drosophila)
domestic guinea pig(100730409) sprouty homolog 3 (Drosophila)
chicken(428712) sprouty homolog 3 (Drosophila)
domestic cat(101094659) sprouty homolog 3 (Drosophila)
dog(492271) sprouty homolog 3 (Drosophila)
346 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50519 Anti-SPRY3 antibody produced in rabbit affinity isolated antibody rat, rabbit, bovine, guinea pig, horse, human, mouse
western blot pricing
SAB1306760 ANTI-SPRY3(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2105750 Anti-SPRY3, (N-terminal) antibody produced in rabbit affinity isolated antibody human, guinea pig, horse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_142331 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_142331 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_142331 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005840 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005840 Rosetta Predictions human pricing
NM_001109063 Rosetta Predictions rat pricing
NM_001030293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229600 predicted 505
2 SASI_Hs01_00229601 predicted 1549
3 SASI_Hs01_00229602 predicted 1319
4 SASI_Hs01_00229603 predicted 1015
5 SASI_Hs01_00229604 predicted 1400
6 SASI_Hs01_00229605 predicted 696
7 SASI_Hs01_00229606 predicted 1407
8 SASI_Hs02_00340377 predicted 1268
9 SASI_Hs02_00340378 predicted 1501
10 SASI_Hs01_00229608 predicted 1084
11 SASI_Hs01_00229599 predicted 1420
12 SASI_Hs01_00229607 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109063 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244760 predicted 702
2 SASI_Rn02_00244761 predicted 527
3 SASI_Rn02_00244762 predicted 858
4 SASI_Rn02_00244763 predicted 701
5 SASI_Rn02_00244764 predicted 711
6 SASI_Rn02_00244765 predicted 590
7 SASI_Rn02_00244766 predicted 683
8 SASI_Rn02_00244767 predicted 647
9 SASI_Rn02_00244768 predicted 547
10 SASI_Rn02_00244769 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180105 predicted 1544
2 SASI_Mm01_00180106 predicted 1331
3 SASI_Mm01_00180107 predicted 1001
4 SASI_Mm01_00180108 predicted 833
5 SASI_Mm01_00180109 predicted 1384
6 SASI_Mm01_00180110 predicted 679
7 SASI_Mm01_00180111 predicted 1213
8 SASI_Mm01_00180112 predicted 865
9 SASI_Mm02_00288125 predicted 1333
10 SASI_Mm01_00180113 predicted 1440
11 SASI_Mm01_00180114 predicted 1302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_142331
SPRY3 MISSION shRNA Bacterial Glycerol Stock
sprouty homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-243s1c1
Sequence:CCGGGTCTAGTATTTCCAGCTCAATCTCGAGATTGAGCTGGAAATACTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-671s1c1
Sequence:CCGGCCATGAGTCTCATCTCCCTTTCTCGAGAAAGGGAGATGAGACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-97s1c1
Sequence:CCGGGCACCCTGTAAACAAGCTCTTCTCGAGAAGAGCTTGTTTACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-539s1c1
Sequence:CCGGGCCTCCTTGATTATGGCACTTCTCGAGAAGTGCCATAATCAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-398s1c1
Sequence:CCGGCTGAGCAATCTGTAGGGCATTCTCGAGAATGCCCTACAGATTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_142331
SPRY3 MISSION shRNA shRNA Plasmid DNA
sprouty homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-243s1c1
Sequence:CCGGGTCTAGTATTTCCAGCTCAATCTCGAGATTGAGCTGGAAATACTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-671s1c1
Sequence:CCGGCCATGAGTCTCATCTCCCTTTCTCGAGAAAGGGAGATGAGACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-97s1c1
Sequence:CCGGGCACCCTGTAAACAAGCTCTTCTCGAGAAGAGCTTGTTTACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-539s1c1
Sequence:CCGGGCCTCCTTGATTATGGCACTTCTCGAGAAGTGCCATAATCAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-398s1c1
Sequence:CCGGCTGAGCAATCTGTAGGGCATTCTCGAGAATGCCCTACAGATTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_142331
SPRY3 MISSION shRNA Lentiviral Transduction Particles
sprouty homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-243s1c1
Sequence:CCGGGTCTAGTATTTCCAGCTCAATCTCGAGATTGAGCTGGAAATACTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-671s1c1
Sequence:CCGGCCATGAGTCTCATCTCCCTTTCTCGAGAAAGGGAGATGAGACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-97s1c1
Sequence:CCGGGCACCCTGTAAACAAGCTCTTCTCGAGAAGAGCTTGTTTACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-539s1c1
Sequence:CCGGGCCTCCTTGATTATGGCACTTCTCGAGAAGTGCCATAATCAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142331.1-398s1c1
Sequence:CCGGCTGAGCAATCTGTAGGGCATTCTCGAGAATGCCCTACAGATTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005840
SPRY3 MISSION shRNA Bacterial Glycerol Stock
sprouty homolog 3 (Drosophila)
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000056811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005840.1-1050s1c1
Sequence:CCGGCCACTGATGATGAAGACAACTCTCGAGAGTTGTCTTCATCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005840
SPRY3 MISSION shRNA shRNA Plasmid DNA
sprouty homolog 3 (Drosophila)
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000056811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005840.1-1050s1c1
Sequence:CCGGCCACTGATGATGAAGACAACTCTCGAGAGTTGTCTTCATCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005840
SPRY3 MISSION shRNA Lentiviral Transduction Particles
sprouty homolog 3 (Drosophila)
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000056811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005840.1-1050s1c1
Sequence:CCGGCCACTGATGATGAAGACAACTCTCGAGAGTTGTCTTCATCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks