EMAIL THIS PAGE TO A FRIEND

SPRY4

sprouty homolog 4 (Drosophila)

Synonyms: HH17
UniProtKB ID: Q9C004, A4FVB2, A4FVB3, Q6QIX2, Q9C003
Gene ID:
Human(81848) Summary: SPRY4 is an inhibitor of the receptor-transduced mitogen-activated protein kinase (MAPK) signaling pathway. It is positioned upstream of RAS (see HRAS; MIM 190020) activation and impairs the formation of active GTP-RAS (Leeksma et al., 2002 [PubMed 12027893]
Mouse(24066) sprouty homolog 4 (Drosophila)
Rat(291610) sprouty homolog 4 (Drosophila)
Zebrafish(114437) sprouty (Drosophila) homolog 4
domestic cat(101081950) sprouty homolog 4 (Drosophila)
dog(487192) sprouty homolog 4 (Drosophila)
chicken(427643) sprouty homolog 4 (Drosophila)
domestic guinea pig(100726876) sprouty homolog 4 (Drosophila)
naked mole-rat(101716643) sprouty homolog 4 (Drosophila)
cow(504593) sprouty homolog 4 (Drosophila)
sheep(101106589) sprouty homolog 4 (Drosophila)
203 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030964 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127496 Rosetta Predictions human pricing
NM_030964 Rosetta Predictions human pricing
NM_001106150 Rosetta Predictions rat pricing
NM_011898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329684 predicted 573
2 SASI_Hs02_00329685 predicted 1134
3 SASI_Hs02_00329686 predicted 1197
4 SASI_Hs02_00329687 predicted 1063
5 SASI_Hs02_00329688 predicted 1196
6 SASI_Hs02_00329689 predicted 573
7 SASI_Hs02_00329690 predicted 496
8 SASI_Hs02_00329691 predicted 837
9 SASI_Hs02_00329692 predicted 895
10 SASI_Hs02_00329693 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032389 predicted 625
2 SASI_Hs01_00032391 predicted 1189
3 SASI_Hs02_00358548 predicted 1246
4 SASI_Hs01_00032393 predicted 1121
5 SASI_Hs02_00358549 predicted 1248
6 SASI_Hs01_00032395 predicted 626
7 SASI_Hs01_00032397 predicted 551
8 SASI_Hs02_00358550 predicted 888
9 SASI_Hs02_00358551 predicted 942
10 SASI_Hs02_00358552 predicted 886
11 SASI_Hs01_00032390 predicted 388
12 SASI_Hs01_00032392 predicted 222
13 SASI_Hs01_00032394 predicted 392
14 SASI_Hs01_00032396 predicted 589
15 SASI_Hs01_00032398 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216118 predicted 1646
2 SASI_Rn02_00216119 predicted 1359
3 SASI_Rn02_00216120 predicted 1641
4 SASI_Rn02_00216121 predicted 1543
5 SASI_Rn02_00216122 predicted 1582
6 SASI_Rn02_00216123 predicted 1630
7 SASI_Rn02_00216124 predicted 327
8 SASI_Rn02_00216125 predicted 1585
9 SASI_Rn02_00216126 predicted 443
10 SASI_Rn02_00216127 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047003 predicted 255
2 SASI_Mm01_00047005 predicted 594
3 SASI_Mm01_00047006 predicted 1432
4 SASI_Mm01_00047007 predicted 1391
5 SASI_Mm01_00047008 predicted 246
6 SASI_Mm01_00047009 predicted 1518
7 SASI_Mm01_00047010 predicted 1529
8 SASI_Mm01_00047011 predicted 1035
9 SASI_Mm01_00047012 predicted 1027
10 SASI_Mm02_00321709 predicted 287
11 SASI_Mm01_00047004 predicted 1309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030964
VALIDATED
SPRY4 MISSION shRNA Bacterial Glycerol Stock
sprouty homolog 4 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030964.2-395s1c1
Sequence:CCGGCATGTGGAGAATGACTACATACTCGAGTATGTAGTCATTCTCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030964.2-739s1c1
Sequence:CCGGCTGTGGGAAGTGTAAATGCAACTCGAGTTGCATTTACACTTCCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030964.2-824s1c1
Sequence:CCGGGCCCAGACTCTGGTCAACTATCTCGAGATAGTTGACCAGAGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030964.2-367s1c1
Sequence:CCGGCCTACCCATTGACCAGGTGAACTCGAGTTCACCTGGTCAATGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030964.2-580s1c1
Sequence:CCGGCCAACGGCTCTTAGACCACATCTCGAGATGTGGTCTAAGAGCCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030964.3-879s21c1
Sequence:CCGGCCCAGACTCTGGTCAACTATGCTCGAGCATAGTTGACCAGAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030964.3-3504s21c1
Sequence:CCGGCTACCGACAAAGACCCTATTTCTCGAGAAATAGGGTCTTTGTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030964.3-1197s21c1
Sequence:CCGGACAAGCCTTTCTGACAGTTTGCTCGAGCAAACTGTCAGAAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030964.3-929s21c1
Sequence:CCGGTTCTACCACTGCACGAATGAGCTCGAGCTCATTCGTGCAGTGGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030964.3-789s21c1
Sequence:CCGGAGGCCTGTGGGAAGTGTAAATCTCGAGATTTACACTTCCCACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030964
VALIDATED
SPRY4 MISSION shRNA shRNA Plasmid DNA
sprouty homolog 4 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030964.2-395s1c1
Sequence:CCGGCATGTGGAGAATGACTACATACTCGAGTATGTAGTCATTCTCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030964.2-739s1c1
Sequence:CCGGCTGTGGGAAGTGTAAATGCAACTCGAGTTGCATTTACACTTCCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030964.2-824s1c1
Sequence:CCGGGCCCAGACTCTGGTCAACTATCTCGAGATAGTTGACCAGAGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030964.2-367s1c1
Sequence:CCGGCCTACCCATTGACCAGGTGAACTCGAGTTCACCTGGTCAATGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030964.2-580s1c1
Sequence:CCGGCCAACGGCTCTTAGACCACATCTCGAGATGTGGTCTAAGAGCCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030964.3-879s21c1
Sequence:CCGGCCCAGACTCTGGTCAACTATGCTCGAGCATAGTTGACCAGAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030964.3-3504s21c1
Sequence:CCGGCTACCGACAAAGACCCTATTTCTCGAGAAATAGGGTCTTTGTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030964.3-1197s21c1
Sequence:CCGGACAAGCCTTTCTGACAGTTTGCTCGAGCAAACTGTCAGAAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030964.3-929s21c1
Sequence:CCGGTTCTACCACTGCACGAATGAGCTCGAGCTCATTCGTGCAGTGGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030964.3-789s21c1
Sequence:CCGGAGGCCTGTGGGAAGTGTAAATCTCGAGATTTACACTTCCCACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030964
VALIDATED
SPRY4 MISSION shRNA Lentiviral Transduction Particles
sprouty homolog 4 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030964.2-395s1c1
Sequence:CCGGCATGTGGAGAATGACTACATACTCGAGTATGTAGTCATTCTCCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030964.2-739s1c1
Sequence:CCGGCTGTGGGAAGTGTAAATGCAACTCGAGTTGCATTTACACTTCCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030964.2-824s1c1
Sequence:CCGGGCCCAGACTCTGGTCAACTATCTCGAGATAGTTGACCAGAGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030964.2-367s1c1
Sequence:CCGGCCTACCCATTGACCAGGTGAACTCGAGTTCACCTGGTCAATGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030964.2-580s1c1
Sequence:CCGGCCAACGGCTCTTAGACCACATCTCGAGATGTGGTCTAAGAGCCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_030964.3-879s21c1
Sequence:CCGGCCCAGACTCTGGTCAACTATGCTCGAGCATAGTTGACCAGAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030964.3-3504s21c1
Sequence:CCGGCTACCGACAAAGACCCTATTTCTCGAGAAATAGGGTCTTTGTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030964.3-1197s21c1
Sequence:CCGGACAAGCCTTTCTGACAGTTTGCTCGAGCAAACTGTCAGAAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030964.3-929s21c1
Sequence:CCGGTTCTACCACTGCACGAATGAGCTCGAGCTCATTCGTGCAGTGGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030964.3-789s21c1
Sequence:CCGGAGGCCTGTGGGAAGTGTAAATCTCGAGATTTACACTTCCCACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011898
VALIDATED
SPRY4 MISSION shRNA Bacterial Glycerol Stock
sprouty homolog 4 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011898.2-249s1c1
Sequence:CCGGCCACTCACCATCTTACCCATTCTCGAGAATGGGTAAGATGGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011898.2-384s1c1
Sequence:CCGGGCCCGCTGTGACCAGGATATTCTCGAGAATATCCTGGTCACAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011898.2-632s1c1
Sequence:CCGGCTGTGGAAAGTGTAAGTGCAACTCGAGTTGCACTTACACTTTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011898.2-753s1c1
Sequence:CCGGCTGGTGCAAGGTATCTTCTATCTCGAGATAGAAGATACCTTGCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011898.2-774s1c1
Sequence:CCGGCACTGTACTAATGAGGATGATCTCGAGATCATCCTCATTAGTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-288s21c1
Sequence:CCGGCACGTGGAGAATGACTACATACTCGAGTATGTAGTCATTCTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-718s21c1
Sequence:CCGGCTCAGACGCTGGTCAACTATGCTCGAGCATAGTTGACCAGCGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-3182s21c1
Sequence:CCGGTGTGGACAGTTGAGCTATATACTCGAGTATATAGCTCAACTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-766s21c1
Sequence:CCGGTCTTCTATCACTGTACTAATGCTCGAGCATTAGTACAGTGATAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-627s21c1
Sequence:CCGGGAGGCCTGTGGAAAGTGTAAGCTCGAGCTTACACTTTCCACAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011898
VALIDATED
SPRY4 MISSION shRNA shRNA Plasmid DNA
sprouty homolog 4 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011898.2-249s1c1
Sequence:CCGGCCACTCACCATCTTACCCATTCTCGAGAATGGGTAAGATGGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011898.2-384s1c1
Sequence:CCGGGCCCGCTGTGACCAGGATATTCTCGAGAATATCCTGGTCACAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011898.2-632s1c1
Sequence:CCGGCTGTGGAAAGTGTAAGTGCAACTCGAGTTGCACTTACACTTTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011898.2-753s1c1
Sequence:CCGGCTGGTGCAAGGTATCTTCTATCTCGAGATAGAAGATACCTTGCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011898.2-774s1c1
Sequence:CCGGCACTGTACTAATGAGGATGATCTCGAGATCATCCTCATTAGTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-288s21c1
Sequence:CCGGCACGTGGAGAATGACTACATACTCGAGTATGTAGTCATTCTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-718s21c1
Sequence:CCGGCTCAGACGCTGGTCAACTATGCTCGAGCATAGTTGACCAGCGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-3182s21c1
Sequence:CCGGTGTGGACAGTTGAGCTATATACTCGAGTATATAGCTCAACTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-766s21c1
Sequence:CCGGTCTTCTATCACTGTACTAATGCTCGAGCATTAGTACAGTGATAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-627s21c1
Sequence:CCGGGAGGCCTGTGGAAAGTGTAAGCTCGAGCTTACACTTTCCACAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011898
VALIDATED
SPRY4 MISSION shRNA Lentiviral Transduction Particles
sprouty homolog 4 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011898.2-249s1c1
Sequence:CCGGCCACTCACCATCTTACCCATTCTCGAGAATGGGTAAGATGGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011898.2-384s1c1
Sequence:CCGGGCCCGCTGTGACCAGGATATTCTCGAGAATATCCTGGTCACAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011898.2-632s1c1
Sequence:CCGGCTGTGGAAAGTGTAAGTGCAACTCGAGTTGCACTTACACTTTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011898.2-753s1c1
Sequence:CCGGCTGGTGCAAGGTATCTTCTATCTCGAGATAGAAGATACCTTGCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011898.2-774s1c1
Sequence:CCGGCACTGTACTAATGAGGATGATCTCGAGATCATCCTCATTAGTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-288s21c1
Sequence:CCGGCACGTGGAGAATGACTACATACTCGAGTATGTAGTCATTCTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-718s21c1
Sequence:CCGGCTCAGACGCTGGTCAACTATGCTCGAGCATAGTTGACCAGCGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-3182s21c1
Sequence:CCGGTGTGGACAGTTGAGCTATATACTCGAGTATATAGCTCAACTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-766s21c1
Sequence:CCGGTCTTCTATCACTGTACTAATGCTCGAGCATTAGTACAGTGATAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011898.2-627s21c1
Sequence:CCGGGAGGCCTGTGGAAAGTGTAAGCTCGAGCTTACACTTTCCACAGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks