EMAIL THIS PAGE TO A FRIEND

SPRYD3

SPRY domain containing 3

UniProtKB ID: Q8NCJ5, B9EG99, Q96SK5
Gene ID:
Mouse(223918) SPRY domain containing 3
Rat(315327) SPRY domain containing 3
Zebrafish(100005036) SPRY domain containing 3
chicken(100858430) SPRY domain containing 3
dog(486512) SPRY domain containing 3
Horse(100056536) SPRY domain containing 3
domestic cat(101082501) SPRY domain containing 3
cow(534570) SPRY domain containing 3
sheep(101107428) SPRY domain containing 3
naked mole-rat(101717204) SPRY domain containing 3
domestic guinea pig(100735125) SPRY domain containing 3
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032840 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032840 Rosetta Predictions human pricing
XM_001066532 Rosetta Predictions rat pricing
XM_235711 Rosetta Predictions rat pricing
NM_001033277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064083 predicted 1579
2 SASI_Hs01_00064084 predicted 682
3 SASI_Hs01_00064085 predicted 1754
4 SASI_Hs01_00064086 predicted 455
5 SASI_Hs02_00360436 predicted 346
6 SASI_Hs01_00064087 predicted 856
7 SASI_Hs01_00064088 predicted 706
8 SASI_Hs01_00064089 predicted 1695
9 SASI_Hs01_00064090 predicted 904
10 SASI_Hs01_00064091 predicted 1682
11 SASI_Hs01_00064092 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317833 predicted 469
2 SASI_Rn02_00317834 predicted 243
3 SASI_Rn02_00317835 predicted 847
4 SASI_Rn02_00317836 predicted 205
5 SASI_Rn02_00317837 predicted 615
6 SASI_Rn02_00317838 predicted 400
7 SASI_Rn02_00317839 predicted 701
8 SASI_Rn02_00317840 predicted 221
9 SASI_Rn02_00317841 predicted 629
10 SASI_Rn02_00317842 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389616 predicted 470
2 SASI_Rn02_00389617 predicted 245
3 SASI_Rn02_00389618 predicted 842
4 SASI_Rn02_00389619 predicted 206
5 SASI_Rn02_00389620 predicted 614
6 SASI_Rn02_00389621 predicted 403
7 SASI_Rn02_00389622 predicted 700
8 SASI_Rn02_00389623 predicted 222
9 SASI_Rn02_00389624 predicted 633
10 SASI_Rn02_00389625 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036234 predicted 214
2 SASI_Mm01_00036235 predicted 230
3 SASI_Mm01_00036236 predicted 595
4 SASI_Mm01_00036238 predicted 679
5 SASI_Mm02_00288471 predicted 1558
6 SASI_Mm01_00036239 predicted 377
7 SASI_Mm01_00036240 predicted 937
8 SASI_Mm01_00036241 predicted 198
9 SASI_Mm01_00036242 predicted 890
10 SASI_Mm01_00036243 predicted 764
11 SASI_Mm01_00036237 predicted 509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033277
VALIDATED
SPRYD3 MISSION shRNA Bacterial Glycerol Stock
SPRY domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-2171s21c1
Sequence:CCGGTTGATTCTAGTGTCTATATAGCTCGAGCTATATAGACACTAGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-183s21c1
Sequence:CCGGTCAGGAGAGGTTCAAGCATATCTCGAGATATGCTTGAACCTCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-279s21c1
Sequence:CCGGGACCAAGGACAGCAATTATTTCTCGAGAAATAATTGCTGTCCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-222s21c1
Sequence:CCGGTTTGAGTTACCATGGAAATTCCTCGAGGAATTTCCATGGTAACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-1011s21c1
Sequence:CCGGCTGCTACAAAGGAGACATTATCTCGAGATAATGTCTCCTTTGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033277
VALIDATED
SPRYD3 MISSION shRNA shRNA Plasmid DNA
SPRY domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-2171s21c1
Sequence:CCGGTTGATTCTAGTGTCTATATAGCTCGAGCTATATAGACACTAGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-183s21c1
Sequence:CCGGTCAGGAGAGGTTCAAGCATATCTCGAGATATGCTTGAACCTCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-279s21c1
Sequence:CCGGGACCAAGGACAGCAATTATTTCTCGAGAAATAATTGCTGTCCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-222s21c1
Sequence:CCGGTTTGAGTTACCATGGAAATTCCTCGAGGAATTTCCATGGTAACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-1011s21c1
Sequence:CCGGCTGCTACAAAGGAGACATTATCTCGAGATAATGTCTCCTTTGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033277
VALIDATED
SPRYD3 MISSION shRNA Lentiviral Transduction Particles
SPRY domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-2171s21c1
Sequence:CCGGTTGATTCTAGTGTCTATATAGCTCGAGCTATATAGACACTAGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-183s21c1
Sequence:CCGGTCAGGAGAGGTTCAAGCATATCTCGAGATATGCTTGAACCTCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-279s21c1
Sequence:CCGGGACCAAGGACAGCAATTATTTCTCGAGAAATAATTGCTGTCCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-222s21c1
Sequence:CCGGTTTGAGTTACCATGGAAATTCCTCGAGGAATTTCCATGGTAACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001033277.3-1011s21c1
Sequence:CCGGCTGCTACAAAGGAGACATTATCTCGAGATAATGTCTCCTTTGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032840
VALIDATED
SPRYD3 MISSION shRNA Bacterial Glycerol Stock
SPRY domain containing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032840.1-1226s21c1
Sequence:CCGGCTCGGAATGGCAAGATCATTGCTCGAGCAATGATCTTGCCATTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032840.1-175s21c1
Sequence:CCGGGATGGAGATACTTTAAGTTATCTCGAGATAACTTAAAGTATCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032840.1-1748s21c1
Sequence:CCGGCCCTACTCACCATGGTATTTCCTCGAGGAAATACCATGGTGAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032840.1-710s21c1
Sequence:CCGGGGACTCTGCTGGAGTACTTAGCTCGAGCTAAGTACTCCAGCAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032840.1-127s21c1
Sequence:CCGGGAGGTCCGAGCTTTCCGATATCTCGAGATATCGGAAAGCTCGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032840.1-1581s1c1
Sequence:CCGGCCCAAAGAATGGTGTTGGTATCTCGAGATACCAACACCATTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032840.1-151s1c1
Sequence:CCGGGAGAGGTTCAAACATATCCTTCTCGAGAAGGATATGTTTGAACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032840.1-243s1c1
Sequence:CCGGGACCAAGGACAGCAATTATTTCTCGAGAAATAATTGCTGTCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032840.1-241s1c1
Sequence:CCGGCTGACCAAGGACAGCAATTATCTCGAGATAATTGCTGTCCTTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032840.1-2292s1c1
Sequence:CCGGCAGTGTTTGATTCTAGCACTTCTCGAGAAGTGCTAGAATCAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032840
VALIDATED
SPRYD3 MISSION shRNA shRNA Plasmid DNA
SPRY domain containing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032840.1-1226s21c1
Sequence:CCGGCTCGGAATGGCAAGATCATTGCTCGAGCAATGATCTTGCCATTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032840.1-175s21c1
Sequence:CCGGGATGGAGATACTTTAAGTTATCTCGAGATAACTTAAAGTATCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032840.1-1748s21c1
Sequence:CCGGCCCTACTCACCATGGTATTTCCTCGAGGAAATACCATGGTGAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032840.1-710s21c1
Sequence:CCGGGGACTCTGCTGGAGTACTTAGCTCGAGCTAAGTACTCCAGCAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032840.1-127s21c1
Sequence:CCGGGAGGTCCGAGCTTTCCGATATCTCGAGATATCGGAAAGCTCGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032840.1-1581s1c1
Sequence:CCGGCCCAAAGAATGGTGTTGGTATCTCGAGATACCAACACCATTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032840.1-151s1c1
Sequence:CCGGGAGAGGTTCAAACATATCCTTCTCGAGAAGGATATGTTTGAACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032840.1-243s1c1
Sequence:CCGGGACCAAGGACAGCAATTATTTCTCGAGAAATAATTGCTGTCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032840.1-241s1c1
Sequence:CCGGCTGACCAAGGACAGCAATTATCTCGAGATAATTGCTGTCCTTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032840.1-2292s1c1
Sequence:CCGGCAGTGTTTGATTCTAGCACTTCTCGAGAAGTGCTAGAATCAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032840
VALIDATED
SPRYD3 MISSION shRNA Lentiviral Transduction Particles
SPRY domain containing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032840.1-1226s21c1
Sequence:CCGGCTCGGAATGGCAAGATCATTGCTCGAGCAATGATCTTGCCATTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032840.1-175s21c1
Sequence:CCGGGATGGAGATACTTTAAGTTATCTCGAGATAACTTAAAGTATCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032840.1-1748s21c1
Sequence:CCGGCCCTACTCACCATGGTATTTCCTCGAGGAAATACCATGGTGAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032840.1-710s21c1
Sequence:CCGGGGACTCTGCTGGAGTACTTAGCTCGAGCTAAGTACTCCAGCAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032840.1-127s21c1
Sequence:CCGGGAGGTCCGAGCTTTCCGATATCTCGAGATATCGGAAAGCTCGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032840.1-1581s1c1
Sequence:CCGGCCCAAAGAATGGTGTTGGTATCTCGAGATACCAACACCATTCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032840.1-151s1c1
Sequence:CCGGGAGAGGTTCAAACATATCCTTCTCGAGAAGGATATGTTTGAACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032840.1-243s1c1
Sequence:CCGGGACCAAGGACAGCAATTATTTCTCGAGAAATAATTGCTGTCCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032840.1-241s1c1
Sequence:CCGGCTGACCAAGGACAGCAATTATCTCGAGATAATTGCTGTCCTTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032840.1-2292s1c1
Sequence:CCGGCAGTGTTTGATTCTAGCACTTCTCGAGAAGTGCTAGAATCAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks