EMAIL THIS PAGE TO A FRIEND

SPRYD4

SPRY domain containing 4

UniProtKB ID: Q8WW59, A8K7A5
Gene ID:
Mouse(66701) SPRY domain containing 4
Rat(288772) SPRY domain containing 4
domestic guinea pig(100731870) SPRY domain containing 4
naked mole-rat(101704874) SPRY domain containing 4
cow(539560) SPRY domain containing 4
sheep(101107686) SPRY domain containing 4
Zebrafish(100005939) SPRY domain containing 4
domestic cat(101099983) SPRY domain containing 4
dog(481113) SPRY domain containing 4
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207344 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU023161 MISSION® esiRNA esiRNA targeting mouse Spryd4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207344 Rosetta Predictions human pricing
NM_001037765 Rosetta Predictions rat pricing
NM_025716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200027 predicted 741
2 SASI_Hs01_00200028 predicted 845
3 SASI_Hs01_00200031 predicted 267
4 SASI_Hs01_00200032 predicted 817
5 SASI_Hs02_00373896 predicted 212
6 SASI_Hs02_00373897 predicted 1151
7 SASI_Hs02_00373898 predicted 1147
8 SASI_Hs02_00373899 predicted 213
9 SASI_Hs02_00373900 predicted 1173
10 SASI_Hs02_00373901 predicted 496
11 SASI_Hs01_00200026 predicted 263
12 SASI_Hs01_00200029 predicted 376
13 SASI_Hs01_00200030 predicted 415
14 SASI_Hs01_00200033 predicted 487
15 SASI_Hs01_00200034 predicted 666
16 SASI_Hs01_00200035 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204551 predicted 1040
2 SASI_Rn01_00088748 predicted 963
3 SASI_Rn01_00088749 predicted 729
4 SASI_Rn01_00088750 predicted 666
5 SASI_Rn01_00088751 predicted 723
6 SASI_Rn01_00088752 predicted 986
7 SASI_Rn01_00088753 predicted 420
8 SASI_Rn01_00088754 predicted 473
9 SASI_Rn01_00088755 predicted 619
10 SASI_Rn01_00088756 predicted 1048
11 SASI_Rn01_00088757 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118262 predicted 663
2 SASI_Mm01_00118263 predicted 949
3 SASI_Mm01_00118264 predicted 387
4 SASI_Mm01_00118265 predicted 330
5 SASI_Mm01_00118266 predicted 833
6 SASI_Mm01_00118267 predicted 695
7 SASI_Mm01_00118268 predicted 914
8 SASI_Mm01_00118269 predicted 420
9 SASI_Mm01_00118270 predicted 715
10 SASI_Mm01_00118271 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207344
SPRYD4 MISSION shRNA Bacterial Glycerol Stock
SPRY domain containing 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207344.1-95s1c1
Sequence:CCGGGAGAGGCGTCAGTTTCAAACTCTCGAGAGTTTGAAACTGACGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172313    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207344.1-836s1c1
Sequence:CCGGCCACCAACACTACTGCCAATTCTCGAGAATTGGCAGTAGTGTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207344.1-152s1c1
Sequence:CCGGCAGAGATGATACGGGTGTCAACTCGAGTTGACACCCGTATCATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166946    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207344.1-954s1c1
Sequence:CCGGGTCTTATCATTCAGCTTTGTTCTCGAGAACAAAGCTGAATGATAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207344.3-217s21c1
Sequence:GTACCGGGATGATACGGGTGTCAAATATCTCGAGATATTTGACACCCGTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207344.3-1358s21c1
Sequence:CCGGGCCAGTCTGTCATAATCATTACTCGAGTAATGATTATGACAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207344.3-690s21c1
Sequence:CCGGGGGCCTCTAGTATGTCCATTACTCGAGTAATGGACATACTAGAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207344.3-594s21c1
Sequence:CCGGTCACACGCTACAGACAGATTTCTCGAGAAATCTGTCTGTAGCGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207344.3-473s21c1
Sequence:CCGGCCATGTTGGCCAACGAGAAAGCTCGAGCTTTCTCGTTGGCCAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207344
SPRYD4 MISSION shRNA shRNA Plasmid DNA
SPRY domain containing 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207344.1-95s1c1
Sequence:CCGGGAGAGGCGTCAGTTTCAAACTCTCGAGAGTTTGAAACTGACGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172313    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207344.1-836s1c1
Sequence:CCGGCCACCAACACTACTGCCAATTCTCGAGAATTGGCAGTAGTGTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207344.1-152s1c1
Sequence:CCGGCAGAGATGATACGGGTGTCAACTCGAGTTGACACCCGTATCATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166946    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207344.1-954s1c1
Sequence:CCGGGTCTTATCATTCAGCTTTGTTCTCGAGAACAAAGCTGAATGATAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207344.3-217s21c1
Sequence:GTACCGGGATGATACGGGTGTCAAATATCTCGAGATATTTGACACCCGTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207344.3-1358s21c1
Sequence:CCGGGCCAGTCTGTCATAATCATTACTCGAGTAATGATTATGACAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207344.3-690s21c1
Sequence:CCGGGGGCCTCTAGTATGTCCATTACTCGAGTAATGGACATACTAGAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207344.3-594s21c1
Sequence:CCGGTCACACGCTACAGACAGATTTCTCGAGAAATCTGTCTGTAGCGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207344.3-473s21c1
Sequence:CCGGCCATGTTGGCCAACGAGAAAGCTCGAGCTTTCTCGTTGGCCAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207344
SPRYD4 MISSION shRNA Lentiviral Transduction Particles
SPRY domain containing 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207344.1-95s1c1
Sequence:CCGGGAGAGGCGTCAGTTTCAAACTCTCGAGAGTTTGAAACTGACGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172313    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207344.1-836s1c1
Sequence:CCGGCCACCAACACTACTGCCAATTCTCGAGAATTGGCAGTAGTGTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207344.1-152s1c1
Sequence:CCGGCAGAGATGATACGGGTGTCAACTCGAGTTGACACCCGTATCATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166946    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207344.1-954s1c1
Sequence:CCGGGTCTTATCATTCAGCTTTGTTCTCGAGAACAAAGCTGAATGATAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207344.3-217s21c1
Sequence:GTACCGGGATGATACGGGTGTCAAATATCTCGAGATATTTGACACCCGTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207344.3-1358s21c1
Sequence:CCGGGCCAGTCTGTCATAATCATTACTCGAGTAATGATTATGACAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207344.3-690s21c1
Sequence:CCGGGGGCCTCTAGTATGTCCATTACTCGAGTAATGGACATACTAGAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207344.3-594s21c1
Sequence:CCGGTCACACGCTACAGACAGATTTCTCGAGAAATCTGTCTGTAGCGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207344.3-473s21c1
Sequence:CCGGCCATGTTGGCCAACGAGAAAGCTCGAGCTTTCTCGTTGGCCAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025716
VALIDATED
SPRYD4 MISSION shRNA Bacterial Glycerol Stock
SPRY domain containing 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025716.1-1422s1c1
Sequence:CCGGCGGAATATACAGTTTGGACTTCTCGAGAAGTCCAAACTGTATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025716.1-520s1c1
Sequence:CCGGCCACACACTACAGACAGATTTCTCGAGAAATCTGTCTGTAGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025716.1-148s1c1
Sequence:CCGGCACGGGTGTCAAATATGGCTTCTCGAGAAGCCATATTTGACACCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025716.1-90s1c1
Sequence:CCGGTCAGTTTCAAACTGGAAGAAACTCGAGTTTCTTCCAGTTTGAAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025716.1-463s1c1
Sequence:CCGGGCTGGACTATGAGGCAAAGAACTCGAGTTCTTTGCCTCATAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-343s21c1
Sequence:CCGGCGTTGGTGCTGATGATCGTTCCTCGAGGAACGATCATCAGCACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025716.2-772s21c1
Sequence:CCGGACTCTGTAAGAGCTAGGTATACTCGAGTATACCTAGCTCTTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-260s21c1
Sequence:CCGGAGACACTACTGGGAGGTAACACTCGAGTGTTACCTCCCAGTAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-668s21c1
Sequence:CCGGCCTTAGTGTCTAAAGCGATTTCTCGAGAAATCGCTTTAGACACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-184s21c1
Sequence:CCGGCACCAAGGTGGCCCTGAATTTCTCGAGAAATTCAGGGCCACCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025716.2-625s21c1
Sequence:CCGGATGTGGCCAAGACCCTGAATCCTCGAGGATTCAGGGTCTTGGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-143s21c1
Sequence:CCGGGGCGACACGGGTGTCAAATATCTCGAGATATTTGACACCCGTGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025716
VALIDATED
SPRYD4 MISSION shRNA shRNA Plasmid DNA
SPRY domain containing 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025716.1-1422s1c1
Sequence:CCGGCGGAATATACAGTTTGGACTTCTCGAGAAGTCCAAACTGTATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025716.1-520s1c1
Sequence:CCGGCCACACACTACAGACAGATTTCTCGAGAAATCTGTCTGTAGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025716.1-148s1c1
Sequence:CCGGCACGGGTGTCAAATATGGCTTCTCGAGAAGCCATATTTGACACCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025716.1-90s1c1
Sequence:CCGGTCAGTTTCAAACTGGAAGAAACTCGAGTTTCTTCCAGTTTGAAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025716.1-463s1c1
Sequence:CCGGGCTGGACTATGAGGCAAAGAACTCGAGTTCTTTGCCTCATAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-343s21c1
Sequence:CCGGCGTTGGTGCTGATGATCGTTCCTCGAGGAACGATCATCAGCACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025716.2-772s21c1
Sequence:CCGGACTCTGTAAGAGCTAGGTATACTCGAGTATACCTAGCTCTTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-260s21c1
Sequence:CCGGAGACACTACTGGGAGGTAACACTCGAGTGTTACCTCCCAGTAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-668s21c1
Sequence:CCGGCCTTAGTGTCTAAAGCGATTTCTCGAGAAATCGCTTTAGACACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-184s21c1
Sequence:CCGGCACCAAGGTGGCCCTGAATTTCTCGAGAAATTCAGGGCCACCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025716.2-625s21c1
Sequence:CCGGATGTGGCCAAGACCCTGAATCCTCGAGGATTCAGGGTCTTGGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-143s21c1
Sequence:CCGGGGCGACACGGGTGTCAAATATCTCGAGATATTTGACACCCGTGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025716
VALIDATED
SPRYD4 MISSION shRNA Lentiviral Transduction Particles
SPRY domain containing 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025716.1-1422s1c1
Sequence:CCGGCGGAATATACAGTTTGGACTTCTCGAGAAGTCCAAACTGTATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025716.1-520s1c1
Sequence:CCGGCCACACACTACAGACAGATTTCTCGAGAAATCTGTCTGTAGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025716.1-148s1c1
Sequence:CCGGCACGGGTGTCAAATATGGCTTCTCGAGAAGCCATATTTGACACCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025716.1-90s1c1
Sequence:CCGGTCAGTTTCAAACTGGAAGAAACTCGAGTTTCTTCCAGTTTGAAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025716.1-463s1c1
Sequence:CCGGGCTGGACTATGAGGCAAAGAACTCGAGTTCTTTGCCTCATAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-343s21c1
Sequence:CCGGCGTTGGTGCTGATGATCGTTCCTCGAGGAACGATCATCAGCACCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025716.2-772s21c1
Sequence:CCGGACTCTGTAAGAGCTAGGTATACTCGAGTATACCTAGCTCTTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-260s21c1
Sequence:CCGGAGACACTACTGGGAGGTAACACTCGAGTGTTACCTCCCAGTAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-668s21c1
Sequence:CCGGCCTTAGTGTCTAAAGCGATTTCTCGAGAAATCGCTTTAGACACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-184s21c1
Sequence:CCGGCACCAAGGTGGCCCTGAATTTCTCGAGAAATTCAGGGCCACCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025716.2-625s21c1
Sequence:CCGGATGTGGCCAAGACCCTGAATCCTCGAGGATTCAGGGTCTTGGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025716.2-143s21c1
Sequence:CCGGGGCGACACGGGTGTCAAATATCTCGAGATATTTGACACCCGTGTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks