EMAIL THIS PAGE TO A FRIEND

SPRYD7

SPRY domain containing 7

Synonyms: C13orf1 CLLD6
UniProtKB ID: Q5W111, A8K3G1, O60648, Q8TBG8, Q96T69
Gene ID:
Mouse(66674) SPRY domain containing 7
Rat(290303) SPRY domain containing 7
chicken(418871) SPRY domain containing 7
dog(476908) SPRY domain containing 7
domestic cat(101093486) SPRY domain containing 7
cow(615298) SPRY domain containing 7
sheep(101118113) SPRY domain containing 7
naked mole-rat(101722285) SPRY domain containing 7
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020456 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127482 Rosetta Predictions human pricing
NM_020456 Rosetta Predictions human pricing
NR_023351 Rosetta Predictions human pricing
NM_001009635 Rosetta Predictions rat pricing
NM_025697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329634 predicted 988
2 SASI_Hs02_00329635 predicted 1018
3 SASI_Hs02_00329636 predicted 1176
4 SASI_Hs02_00329637 predicted 797
5 SASI_Hs02_00329638 predicted 989
6 SASI_Hs02_00329639 predicted 1183
7 SASI_Hs02_00329640 predicted 583
8 SASI_Hs02_00329641 predicted 850
9 SASI_Hs02_00329642 predicted 621
10 SASI_Hs02_00329643 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080045 predicted 1101
2 SASI_Hs02_00353497 predicted 1137
3 SASI_Hs02_00353498 predicted 1298
4 SASI_Hs01_00080049 predicted 910
5 SASI_Hs01_00080051 predicted 1104
6 SASI_Hs02_00353499 predicted 1295
7 SASI_Hs02_00353500 predicted 696
8 SASI_Hs01_00080052 predicted 970
9 SASI_Hs01_00080044 predicted 740
10 SASI_Hs02_00353501 predicted 1233
11 SASI_Hs01_00080046 predicted 797
12 SASI_Hs01_00080047 predicted 681
13 SASI_Hs01_00080048 predicted 216
14 SASI_Hs01_00080050 predicted 500
15 SASI_Hs01_00080053 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381762 predicted 1220
2 SASI_Hs02_00381763 predicted 816
3 SASI_Hs02_00381764 predicted 1362
4 SASI_Hs02_00381765 predicted 1199
5 SASI_Hs02_00381766 predicted 1411
6 SASI_Hs02_00381767 predicted 1186
7 SASI_Hs02_00381768 predicted 623
8 SASI_Hs02_00381769 predicted 1247
9 SASI_Hs02_00381770 predicted 374
10 SASI_Hs02_00381771 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044898 predicted 247
2 SASI_Rn01_00044899 predicted 235
3 SASI_Rn01_00044900 predicted 318
4 SASI_Rn01_00044901 predicted 721
5 SASI_Rn01_00044902 predicted 400
6 SASI_Rn01_00044903 predicted 483
7 SASI_Rn02_00199644 predicted 658
8 SASI_Rn01_00044904 predicted 530
9 SASI_Rn01_00044905 predicted 451
10 SASI_Rn01_00044906 predicted 542
11 SASI_Rn01_00044907 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328862 predicted 486
2 SASI_Mm01_00075025 predicted 756
3 SASI_Mm01_00075026 predicted 704
4 SASI_Mm02_00328863 predicted 498
5 SASI_Mm02_00328864 predicted 653
6 SASI_Mm01_00075027 predicted 863
7 SASI_Mm02_00328865 predicted 575
8 SASI_Mm01_00075028 predicted 902
9 SASI_Mm01_00075029 predicted 837
10 SASI_Mm01_00075033 predicted 944
11 SASI_Mm01_00075030 predicted 900
12 SASI_Mm01_00075031 predicted 768
13 SASI_Mm01_00075032 predicted 699
14 SASI_Mm01_00075034 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020456
VALIDATED
SPRYD7 MISSION shRNA Bacterial Glycerol Stock
SPRY domain containing 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020456.2-733s21c1
Sequence:CCGGGACAGTGTATCCAGTTGTTTACTCGAGTAAACAACTGGATACACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020456.2-503s21c1
Sequence:CCGGGTTGCAACTCAGAAGGTTAACCTCGAGGTTAACCTTCTGAGTTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020456.2-660s21c1
Sequence:CCGGCTTATGACCATGTCGAATTAACTCGAGTTAATTCGACATGGTCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020456.2-998s21c1
Sequence:CCGGCACCCTGAAGTTGTGATTTAACTCGAGTTAAATCACAACTTCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020456.2-407s21c1
Sequence:CCGGTGTGGAACAGGAGGTTGTTTACTCGAGTAAACAACCTCCTGTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020456.1-1721s1c1
Sequence:CCGGCCCTCCTTTATCAACTAGAAACTCGAGTTTCTAGTTGATAAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020456.1-397s1c1
Sequence:CCGGCACAGTCTGGTGATGAGAAATCTCGAGATTTCTCATCACCAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020456.1-503s1c1
Sequence:CCGGCTTATGACCATGTCGAATTAACTCGAGTTAATTCGACATGGTCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020456.1-272s1c1
Sequence:CCGGCCAGCGCACCTTTACATCAAACTCGAGTTTGATGTAAAGGTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020456.1-424s1c1
Sequence:CCGGGCCCTTTACCACAACAATGAACTCGAGTTCATTGTTGTGGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020456
VALIDATED
SPRYD7 MISSION shRNA shRNA Plasmid DNA
SPRY domain containing 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020456.2-733s21c1
Sequence:CCGGGACAGTGTATCCAGTTGTTTACTCGAGTAAACAACTGGATACACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020456.2-503s21c1
Sequence:CCGGGTTGCAACTCAGAAGGTTAACCTCGAGGTTAACCTTCTGAGTTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020456.2-660s21c1
Sequence:CCGGCTTATGACCATGTCGAATTAACTCGAGTTAATTCGACATGGTCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020456.2-998s21c1
Sequence:CCGGCACCCTGAAGTTGTGATTTAACTCGAGTTAAATCACAACTTCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020456.2-407s21c1
Sequence:CCGGTGTGGAACAGGAGGTTGTTTACTCGAGTAAACAACCTCCTGTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020456.1-1721s1c1
Sequence:CCGGCCCTCCTTTATCAACTAGAAACTCGAGTTTCTAGTTGATAAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020456.1-397s1c1
Sequence:CCGGCACAGTCTGGTGATGAGAAATCTCGAGATTTCTCATCACCAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020456.1-503s1c1
Sequence:CCGGCTTATGACCATGTCGAATTAACTCGAGTTAATTCGACATGGTCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020456.1-272s1c1
Sequence:CCGGCCAGCGCACCTTTACATCAAACTCGAGTTTGATGTAAAGGTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020456.1-424s1c1
Sequence:CCGGGCCCTTTACCACAACAATGAACTCGAGTTCATTGTTGTGGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020456
VALIDATED
SPRYD7 MISSION shRNA Lentiviral Transduction Particles
SPRY domain containing 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020456.2-733s21c1
Sequence:CCGGGACAGTGTATCCAGTTGTTTACTCGAGTAAACAACTGGATACACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020456.2-503s21c1
Sequence:CCGGGTTGCAACTCAGAAGGTTAACCTCGAGGTTAACCTTCTGAGTTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020456.2-660s21c1
Sequence:CCGGCTTATGACCATGTCGAATTAACTCGAGTTAATTCGACATGGTCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020456.2-998s21c1
Sequence:CCGGCACCCTGAAGTTGTGATTTAACTCGAGTTAAATCACAACTTCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020456.2-407s21c1
Sequence:CCGGTGTGGAACAGGAGGTTGTTTACTCGAGTAAACAACCTCCTGTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020456.1-1721s1c1
Sequence:CCGGCCCTCCTTTATCAACTAGAAACTCGAGTTTCTAGTTGATAAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020456.1-397s1c1
Sequence:CCGGCACAGTCTGGTGATGAGAAATCTCGAGATTTCTCATCACCAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020456.1-503s1c1
Sequence:CCGGCTTATGACCATGTCGAATTAACTCGAGTTAATTCGACATGGTCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020456.1-272s1c1
Sequence:CCGGCCAGCGCACCTTTACATCAAACTCGAGTTTGATGTAAAGGTGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020456.1-424s1c1
Sequence:CCGGGCCCTTTACCACAACAATGAACTCGAGTTCATTGTTGTGGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025697
SPRYD7 MISSION shRNA Bacterial Glycerol Stock
SPRY domain containing 7
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000191760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025697.1-513s1c1
Sequence:CCGGGAAAGTTAACTTGAACCAGATCTCGAGATCTGGTTCAAGTTAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025697.1-564s1c1
Sequence:CCGGGATGAGAAATGACGGAGCCTTCTCGAGAAGGCTCCGTCATTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025697.1-1285s1c1
Sequence:CCGGGCTGATCTATTTCCTCTGTTACTCGAGTAACAGAGGAAATAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025697.1-1297s1c1
Sequence:CCGGCCTCTGTTAATGGACTACTTTCTCGAGAAAGTAGTCCATTAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025697
SPRYD7 MISSION shRNA shRNA Plasmid DNA
SPRY domain containing 7
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000191760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025697.1-513s1c1
Sequence:CCGGGAAAGTTAACTTGAACCAGATCTCGAGATCTGGTTCAAGTTAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025697.1-564s1c1
Sequence:CCGGGATGAGAAATGACGGAGCCTTCTCGAGAAGGCTCCGTCATTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025697.1-1285s1c1
Sequence:CCGGGCTGATCTATTTCCTCTGTTACTCGAGTAACAGAGGAAATAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025697.1-1297s1c1
Sequence:CCGGCCTCTGTTAATGGACTACTTTCTCGAGAAAGTAGTCCATTAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025697
SPRYD7 MISSION shRNA Lentiviral Transduction Particles
SPRY domain containing 7
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000191760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025697.1-513s1c1
Sequence:CCGGGAAAGTTAACTTGAACCAGATCTCGAGATCTGGTTCAAGTTAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025697.1-564s1c1
Sequence:CCGGGATGAGAAATGACGGAGCCTTCTCGAGAAGGCTCCGTCATTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025697.1-1285s1c1
Sequence:CCGGGCTGATCTATTTCCTCTGTTACTCGAGTAACAGAGGAAATAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025697.1-1297s1c1
Sequence:CCGGCCTCTGTTAATGGACTACTTTCTCGAGAAAGTAGTCCATTAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks