EMAIL THIS PAGE TO A FRIEND

SPSB1

splA/ryanodine receptor domain and SOCS box containing 1

Synonyms: SSB-1 SSB1
UniProtKB ID: Q96BD6, A2A275, Q59FA1, Q5TIH9, Q9BRY9, Q9H6C5
Gene ID:
Mouse(74646) splA/ryanodine receptor domain and SOCS box containing 1
Rat(313722) splA/ryanodine receptor domain and SOCS box containing 1
Zebrafish(334190) splA/ryanodine receptor domain and SOCS box containing 1
dog(479598) splA/ryanodine receptor domain and SOCS box containing 1
domestic cat(101094030) splA/ryanodine receptor domain and SOCS box containing 1
chicken(419441) splA/ryanodine receptor domain and SOCS box containing 1
cow(504407) splA/ryanodine receptor domain and SOCS box containing 1
sheep(101117602) splA/ryanodine receptor domain and SOCS box containing 1
domestic guinea pig(100721617) splA/ryanodine receptor domain and SOCS box containing 1
naked mole-rat(101715182) splA/ryanodine receptor domain and SOCS box containing 1
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025106 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025106 Rosetta Predictions human pricing
NM_001107994 Rosetta Predictions rat pricing
NM_029035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098647 predicted 871
2 SASI_Hs01_00098648 predicted 458
3 SASI_Hs01_00098649 predicted 1378
4 SASI_Hs01_00098650 predicted 1326
5 SASI_Hs01_00098651 predicted 590
6 SASI_Hs01_00098652 predicted 1187
7 SASI_Hs01_00098653 predicted 942
8 SASI_Hs01_00098654 predicted 474
9 SASI_Hs01_00098655 predicted 554
10 SASI_Hs01_00098656 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234315 predicted 505
2 SASI_Rn02_00234316 predicted 819
3 SASI_Rn02_00234317 predicted 880
4 SASI_Rn02_00234318 predicted 609
5 SASI_Rn02_00234319 predicted 690
6 SASI_Rn02_00234320 predicted 393
7 SASI_Rn02_00234321 predicted 496
8 SASI_Rn02_00234322 predicted 1112
9 SASI_Rn02_00234323 predicted 622
10 SASI_Rn02_00234324 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137569 predicted 782
2 SASI_Mm01_00137570 predicted 955
3 SASI_Mm01_00137571 predicted 481
4 SASI_Mm01_00137572 predicted 1538
5 SASI_Mm01_00137573 predicted 1513
6 SASI_Mm02_00334775 predicted 812
7 SASI_Mm01_00137574 predicted 1583
8 SASI_Mm01_00137575 predicted 1108
9 SASI_Mm01_00137576 predicted 1156
10 SASI_Mm01_00137577 predicted 470
11 SASI_Mm01_00137578 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029035
SPSB1 MISSION shRNA Bacterial Glycerol Stock
splA/ryanodine receptor domain and SOCS box containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029035.2-1349s1c1
Sequence:CCGGGCAGAGAATAAACTATGAGAACTCGAGTTCTCATAGTTTATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029035.2-681s1c1
Sequence:CCGGGTTGGGTACACAACCCTTGTACTCGAGTACAAGGGTTGTGTACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029035.2-806s1c1
Sequence:CCGGCGAGACATTCATTGTCCCTGACTCGAGTCAGGGACAATGAATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029035.2-458s21c1
Sequence:CCGGGCTCCACTCCTGGAACAATAACTCGAGTTATTGTTCCAGGAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029035.2-1111s21c1
Sequence:CCGGTCCTCTACCAGTGATCCAAATCTCGAGATTTGGATCACTGGTAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029035.2-848s1c1
Sequence:CCGGCATGGATGATGGGACCTTAAGCTCGAGCTTAAGGTCCCATCATCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029035.2-759s21c1
Sequence:CCGGGGCAAGAACCAGCCAAGTAAACTCGAGTTTACTTGGCTGGTTCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029035.2-2454s21c1
Sequence:CCGGTGGCCATCCTGGGCTATATTACTCGAGTAATATAGCCCAGGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029035.2-581s21c1
Sequence:CCGGCACACGTGGACTGCATGTATGCTCGAGCATACATGCAGTCCACGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029035
SPSB1 MISSION shRNA shRNA Plasmid DNA
splA/ryanodine receptor domain and SOCS box containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029035.2-1349s1c1
Sequence:CCGGGCAGAGAATAAACTATGAGAACTCGAGTTCTCATAGTTTATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029035.2-681s1c1
Sequence:CCGGGTTGGGTACACAACCCTTGTACTCGAGTACAAGGGTTGTGTACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029035.2-806s1c1
Sequence:CCGGCGAGACATTCATTGTCCCTGACTCGAGTCAGGGACAATGAATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029035.2-458s21c1
Sequence:CCGGGCTCCACTCCTGGAACAATAACTCGAGTTATTGTTCCAGGAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029035.2-1111s21c1
Sequence:CCGGTCCTCTACCAGTGATCCAAATCTCGAGATTTGGATCACTGGTAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029035.2-848s1c1
Sequence:CCGGCATGGATGATGGGACCTTAAGCTCGAGCTTAAGGTCCCATCATCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029035.2-759s21c1
Sequence:CCGGGGCAAGAACCAGCCAAGTAAACTCGAGTTTACTTGGCTGGTTCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029035.2-2454s21c1
Sequence:CCGGTGGCCATCCTGGGCTATATTACTCGAGTAATATAGCCCAGGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029035.2-581s21c1
Sequence:CCGGCACACGTGGACTGCATGTATGCTCGAGCATACATGCAGTCCACGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029035
SPSB1 MISSION shRNA Lentiviral Transduction Particles
splA/ryanodine receptor domain and SOCS box containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029035.2-1349s1c1
Sequence:CCGGGCAGAGAATAAACTATGAGAACTCGAGTTCTCATAGTTTATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029035.2-681s1c1
Sequence:CCGGGTTGGGTACACAACCCTTGTACTCGAGTACAAGGGTTGTGTACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029035.2-806s1c1
Sequence:CCGGCGAGACATTCATTGTCCCTGACTCGAGTCAGGGACAATGAATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029035.2-458s21c1
Sequence:CCGGGCTCCACTCCTGGAACAATAACTCGAGTTATTGTTCCAGGAGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029035.2-1111s21c1
Sequence:CCGGTCCTCTACCAGTGATCCAAATCTCGAGATTTGGATCACTGGTAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029035.2-848s1c1
Sequence:CCGGCATGGATGATGGGACCTTAAGCTCGAGCTTAAGGTCCCATCATCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029035.2-759s21c1
Sequence:CCGGGGCAAGAACCAGCCAAGTAAACTCGAGTTTACTTGGCTGGTTCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029035.2-2454s21c1
Sequence:CCGGTGGCCATCCTGGGCTATATTACTCGAGTAATATAGCCCAGGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029035.2-581s21c1
Sequence:CCGGCACACGTGGACTGCATGTATGCTCGAGCATACATGCAGTCCACGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025106
VALIDATED
SPSB1 MISSION shRNA Bacterial Glycerol Stock
splA/ryanodine receptor domain and SOCS box containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_025106.2-1707s1c1
Sequence:CCGGCGTACCCTGTATTTATTCTTTCTCGAGAAAGAATAAATACAGGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_025106.2-963s1c1
Sequence:CCGGCGCTACTTGAACGGACTCGATCTCGAGATCGAGTCCGTTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025106.2-786s1c1
Sequence:CCGGGAACCAGATGAGACATTCATTCTCGAGAATGAATGTCTCATCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025106.2-446s1c1
Sequence:CCGGGCTGCATTCATGGAACAACAACTCGAGTTGTTGTTCCATGAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_025106.2-950s1c1
Sequence:CCGGTGAGATCCGAATGCGCTACTTCTCGAGAAGTAGCGCATTCGGATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_025106.3-835s21c1
Sequence:CCGGGAACCAGATGAGACATTCATTCTCGAGAATGAATGTCTCATCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025106.3-1012s21c1
Sequence:CCGGCGCTACTTGAACGGACTCGATCTCGAGATCGAGTCCGTTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025106.3-495s21c1
Sequence:CCGGGCTGCATTCATGGAACAACAACTCGAGTTGTTGTTCCATGAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025106.3-1756s21c1
Sequence:CCGGCGTACCCTGTATTTATTCTTTCTCGAGAAAGAATAAATACAGGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_025106.3-999s21c1
Sequence:CCGGTGAGATCCGAATGCGCTACTTCTCGAGAAGTAGCGCATTCGGATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025106
VALIDATED
SPSB1 MISSION shRNA shRNA Plasmid DNA
splA/ryanodine receptor domain and SOCS box containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_025106.2-1707s1c1
Sequence:CCGGCGTACCCTGTATTTATTCTTTCTCGAGAAAGAATAAATACAGGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_025106.2-963s1c1
Sequence:CCGGCGCTACTTGAACGGACTCGATCTCGAGATCGAGTCCGTTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025106.2-786s1c1
Sequence:CCGGGAACCAGATGAGACATTCATTCTCGAGAATGAATGTCTCATCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025106.2-446s1c1
Sequence:CCGGGCTGCATTCATGGAACAACAACTCGAGTTGTTGTTCCATGAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_025106.2-950s1c1
Sequence:CCGGTGAGATCCGAATGCGCTACTTCTCGAGAAGTAGCGCATTCGGATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_025106.3-835s21c1
Sequence:CCGGGAACCAGATGAGACATTCATTCTCGAGAATGAATGTCTCATCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025106.3-1012s21c1
Sequence:CCGGCGCTACTTGAACGGACTCGATCTCGAGATCGAGTCCGTTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025106.3-495s21c1
Sequence:CCGGGCTGCATTCATGGAACAACAACTCGAGTTGTTGTTCCATGAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025106.3-1756s21c1
Sequence:CCGGCGTACCCTGTATTTATTCTTTCTCGAGAAAGAATAAATACAGGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_025106.3-999s21c1
Sequence:CCGGTGAGATCCGAATGCGCTACTTCTCGAGAAGTAGCGCATTCGGATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025106
VALIDATED
SPSB1 MISSION shRNA Lentiviral Transduction Particles
splA/ryanodine receptor domain and SOCS box containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_025106.2-1707s1c1
Sequence:CCGGCGTACCCTGTATTTATTCTTTCTCGAGAAAGAATAAATACAGGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_025106.2-963s1c1
Sequence:CCGGCGCTACTTGAACGGACTCGATCTCGAGATCGAGTCCGTTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025106.2-786s1c1
Sequence:CCGGGAACCAGATGAGACATTCATTCTCGAGAATGAATGTCTCATCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025106.2-446s1c1
Sequence:CCGGGCTGCATTCATGGAACAACAACTCGAGTTGTTGTTCCATGAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_025106.2-950s1c1
Sequence:CCGGTGAGATCCGAATGCGCTACTTCTCGAGAAGTAGCGCATTCGGATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_025106.3-835s21c1
Sequence:CCGGGAACCAGATGAGACATTCATTCTCGAGAATGAATGTCTCATCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025106.3-1012s21c1
Sequence:CCGGCGCTACTTGAACGGACTCGATCTCGAGATCGAGTCCGTTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025106.3-495s21c1
Sequence:CCGGGCTGCATTCATGGAACAACAACTCGAGTTGTTGTTCCATGAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025106.3-1756s21c1
Sequence:CCGGCGTACCCTGTATTTATTCTTTCTCGAGAAAGAATAAATACAGGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_025106.3-999s21c1
Sequence:CCGGTGAGATCCGAATGCGCTACTTCTCGAGAAGTAGCGCATTCGGATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks