EMAIL THIS PAGE TO A FRIEND

SPSB2

splA/ryanodine receptor domain and SOCS box containing 2

Synonyms: GRCC9 SSB2
UniProtKB ID: Q99619, D3DUT0
Gene ID:
Human(84727) Summary: This gene encodes encodes a suppressor of cytokine signaling (SOCS) family member, and it belongs to the subfamily of proteins containing a central SPRY (repeats in splA and RyR) domain and a C-terminal SOCS box. This gene is present in a gene-rich cluster on chromosome 12p13 in the vicinity of the CD4 antigen and triosephosphate isomerase genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(14794) splA/ryanodine receptor domain and SOCS box containing 2
Rat(297592) splA/ryanodine receptor domain and SOCS box containing 2
naked mole-rat(101721356) splA/ryanodine receptor domain and SOCS box containing 2
domestic guinea pig(100724255) splA/ryanodine receptor domain and SOCS box containing 2
cow(613651) splA/ryanodine receptor domain and SOCS box containing 2
sheep(101109691) splA/ryanodine receptor domain and SOCS box containing 2
domestic cat(101086156) splA/ryanodine receptor domain and SOCS box containing 2
dog(477710) splA/ryanodine receptor domain and SOCS box containing 2
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032641 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013539 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013539 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013539 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003461 MISSION® esiRNA esiRNA targeting human SPSB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032641 Rosetta Predictions human pricing
NM_001009660 Rosetta Predictions rat pricing
NM_013539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360195 predicted 630
2 SASI_Hs01_00246911 predicted 290
3 SASI_Hs01_00246913 predicted 942
4 SASI_Hs01_00246914 predicted 695
5 SASI_Hs01_00246915 predicted 716
6 SASI_Hs01_00246916 predicted 663
7 SASI_Hs01_00246918 predicted 837
8 SASI_Hs01_00246919 predicted 724
9 SASI_Hs01_00246920 predicted 936
10 SASI_Hs02_00360196 predicted 665
11 SASI_Hs01_00246912 predicted 815
12 SASI_Hs01_00246917 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068750 predicted 690
2 SASI_Rn01_00068751 predicted 863
3 SASI_Rn01_00068752 predicted 250
4 SASI_Rn01_00068755 predicted 684
5 SASI_Rn02_00199689 predicted 797
6 SASI_Rn01_00068756 predicted 799
7 SASI_Rn01_00068757 predicted 468
8 SASI_Rn01_00068758 predicted 799
9 SASI_Rn02_00199690 predicted 727
10 SASI_Rn02_00199691 predicted 905
11 SASI_Rn01_00068749 predicted 366
12 SASI_Rn01_00068753 predicted 699
13 SASI_Rn01_00068754 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070142 predicted 765
2 SASI_Mm01_00070144 predicted 328
3 SASI_Mm01_00070146 predicted 804
4 SASI_Mm01_00070147 predicted 272
5 SASI_Mm01_00070149 predicted 761
6 SASI_Mm01_00070150 predicted 312
7 SASI_Mm01_00070151 predicted 830
8 SASI_Mm02_00322240 predicted 807
9 SASI_Mm02_00322241 predicted 759
10 SASI_Mm02_00322242 predicted 762
11 SASI_Mm01_00070143 predicted 667
12 SASI_Mm01_00070145 predicted 649
13 SASI_Mm01_00070148 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032641
SPSB2 MISSION shRNA Bacterial Glycerol Stock
splA/ryanodine receptor domain and SOCS box containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032641.3-722s21c1
Sequence:CCGGGACATGGAGGAGGGAACTCTGCTCGAGCAGAGTTCCCTCCTCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032641.3-701s21c1
Sequence:CCGGGAGAGACTGCTGGTGGTTCTGCTCGAGCAGAACCACCAGCAGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032641.3-799s21c1
Sequence:CCGGGACCCTCTATCCGGCAGTAAGCTCGAGCTTACTGCCGGATAGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032641.3-735s21c1
Sequence:CCGGGAACTCTGGGCTACGCTATTGCTCGAGCAATAGCGTAGCCCAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032641.3-1015s21c1
Sequence:CCGGCAGACTGTGCTGAGGTCTTGCCTCGAGGCAAGACCTCAGCACAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032641.1-289s1c1
Sequence:CCGGCAAAGACTGTTCAGAGAACATCTCGAGATGTTCTCTGAACAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032641.1-288s1c1
Sequence:CCGGCCAAAGACTGTTCAGAGAACACTCGAGTGTTCTCTGAACAGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032641.1-553s1c1
Sequence:CCGGGAAGCTGTACCATCAGAGCAACTCGAGTTGCTCTGATGGTACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032641.1-297s1c1
Sequence:CCGGGTTCAGAGAACATCGAGGTCACTCGAGTGACCTCGATGTTCTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032641
SPSB2 MISSION shRNA shRNA Plasmid DNA
splA/ryanodine receptor domain and SOCS box containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032641.3-722s21c1
Sequence:CCGGGACATGGAGGAGGGAACTCTGCTCGAGCAGAGTTCCCTCCTCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032641.3-701s21c1
Sequence:CCGGGAGAGACTGCTGGTGGTTCTGCTCGAGCAGAACCACCAGCAGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032641.3-799s21c1
Sequence:CCGGGACCCTCTATCCGGCAGTAAGCTCGAGCTTACTGCCGGATAGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032641.3-735s21c1
Sequence:CCGGGAACTCTGGGCTACGCTATTGCTCGAGCAATAGCGTAGCCCAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032641.3-1015s21c1
Sequence:CCGGCAGACTGTGCTGAGGTCTTGCCTCGAGGCAAGACCTCAGCACAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032641.1-289s1c1
Sequence:CCGGCAAAGACTGTTCAGAGAACATCTCGAGATGTTCTCTGAACAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032641.1-288s1c1
Sequence:CCGGCCAAAGACTGTTCAGAGAACACTCGAGTGTTCTCTGAACAGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032641.1-553s1c1
Sequence:CCGGGAAGCTGTACCATCAGAGCAACTCGAGTTGCTCTGATGGTACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032641.1-297s1c1
Sequence:CCGGGTTCAGAGAACATCGAGGTCACTCGAGTGACCTCGATGTTCTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032641
SPSB2 MISSION shRNA Lentiviral Transduction Particles
splA/ryanodine receptor domain and SOCS box containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032641.3-722s21c1
Sequence:CCGGGACATGGAGGAGGGAACTCTGCTCGAGCAGAGTTCCCTCCTCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032641.3-701s21c1
Sequence:CCGGGAGAGACTGCTGGTGGTTCTGCTCGAGCAGAACCACCAGCAGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032641.3-799s21c1
Sequence:CCGGGACCCTCTATCCGGCAGTAAGCTCGAGCTTACTGCCGGATAGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032641.3-735s21c1
Sequence:CCGGGAACTCTGGGCTACGCTATTGCTCGAGCAATAGCGTAGCCCAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032641.3-1015s21c1
Sequence:CCGGCAGACTGTGCTGAGGTCTTGCCTCGAGGCAAGACCTCAGCACAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032641.1-289s1c1
Sequence:CCGGCAAAGACTGTTCAGAGAACATCTCGAGATGTTCTCTGAACAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032641.1-288s1c1
Sequence:CCGGCCAAAGACTGTTCAGAGAACACTCGAGTGTTCTCTGAACAGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032641.1-553s1c1
Sequence:CCGGGAAGCTGTACCATCAGAGCAACTCGAGTTGCTCTGATGGTACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032641.1-297s1c1
Sequence:CCGGGTTCAGAGAACATCGAGGTCACTCGAGTGACCTCGATGTTCTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013539
VALIDATED
SPSB2 MISSION shRNA Bacterial Glycerol Stock
splA/ryanodine receptor domain and SOCS box containing 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013539.1-1021s21c1
Sequence:CCGGGCTGGCCTAGACAACTTTAAACTCGAGTTTAAAGTTGTCTAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013539.1-696s21c1
Sequence:CCGGGGACTCTTGGCTACTCTATTGCTCGAGCAATAGAGTAGCCAAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013539.1-942s21c1
Sequence:CCGGAGCGCTATCTGCTCTACAAATCTCGAGATTTGTAGAGCAGATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013539.1-328s21c1
Sequence:CCGGCTCCGAGAACATCGATGTCAACTCGAGTTGACATCGATGTTCTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013539.1-894s21c1
Sequence:CCGGACACCCGGCTGGGTCAAATATCTCGAGATATTTGACCCAGCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013539.1-332s1c1
Sequence:CCGGGAGAACATCGATGTCAAGGAACTCGAGTTCCTTGACATCGATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013539.1-824s1c1
Sequence:CCGGGAAAGAAGAGTGGAGGAACCACTCGAGTGGTTCCTCCACTCTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013539.1-328s1c1
Sequence:CCGGCTCCGAGAACATCGATGTCAACTCGAGTTGACATCGATGTTCTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013539.1-901s1c1
Sequence:CCGGGCTGGGTCAAATATCCACTCTCTCGAGAGAGTGGATATTTGACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013539.1-940s1c1
Sequence:CCGGGAAGCGCTATCTGCTCTACAACTCGAGTTGTAGAGCAGATAGCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013539.1-1021s1c1
Sequence:CCGGGCTGGCCTAGACAACTTTAAACTCGAGTTTAAAGTTGTCTAGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013539.1-323s1c1
Sequence:CCGGGATTGCTCCGAGAACATCGATCTCGAGATCGATGTTCTCGGAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013539.1-589s1c1
Sequence:CCGGGTATCATCAGAGTAAGGGCCTCTCGAGAGGCCCTTACTCTGATGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013539
VALIDATED
SPSB2 MISSION shRNA shRNA Plasmid DNA
splA/ryanodine receptor domain and SOCS box containing 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013539.1-1021s21c1
Sequence:CCGGGCTGGCCTAGACAACTTTAAACTCGAGTTTAAAGTTGTCTAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013539.1-696s21c1
Sequence:CCGGGGACTCTTGGCTACTCTATTGCTCGAGCAATAGAGTAGCCAAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013539.1-942s21c1
Sequence:CCGGAGCGCTATCTGCTCTACAAATCTCGAGATTTGTAGAGCAGATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013539.1-328s21c1
Sequence:CCGGCTCCGAGAACATCGATGTCAACTCGAGTTGACATCGATGTTCTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013539.1-894s21c1
Sequence:CCGGACACCCGGCTGGGTCAAATATCTCGAGATATTTGACCCAGCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013539.1-332s1c1
Sequence:CCGGGAGAACATCGATGTCAAGGAACTCGAGTTCCTTGACATCGATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013539.1-824s1c1
Sequence:CCGGGAAAGAAGAGTGGAGGAACCACTCGAGTGGTTCCTCCACTCTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013539.1-328s1c1
Sequence:CCGGCTCCGAGAACATCGATGTCAACTCGAGTTGACATCGATGTTCTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013539.1-901s1c1
Sequence:CCGGGCTGGGTCAAATATCCACTCTCTCGAGAGAGTGGATATTTGACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013539.1-940s1c1
Sequence:CCGGGAAGCGCTATCTGCTCTACAACTCGAGTTGTAGAGCAGATAGCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013539.1-1021s1c1
Sequence:CCGGGCTGGCCTAGACAACTTTAAACTCGAGTTTAAAGTTGTCTAGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013539.1-323s1c1
Sequence:CCGGGATTGCTCCGAGAACATCGATCTCGAGATCGATGTTCTCGGAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013539.1-589s1c1
Sequence:CCGGGTATCATCAGAGTAAGGGCCTCTCGAGAGGCCCTTACTCTGATGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013539
VALIDATED
SPSB2 MISSION shRNA Lentiviral Transduction Particles
splA/ryanodine receptor domain and SOCS box containing 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013539.1-1021s21c1
Sequence:CCGGGCTGGCCTAGACAACTTTAAACTCGAGTTTAAAGTTGTCTAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013539.1-696s21c1
Sequence:CCGGGGACTCTTGGCTACTCTATTGCTCGAGCAATAGAGTAGCCAAGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013539.1-942s21c1
Sequence:CCGGAGCGCTATCTGCTCTACAAATCTCGAGATTTGTAGAGCAGATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013539.1-328s21c1
Sequence:CCGGCTCCGAGAACATCGATGTCAACTCGAGTTGACATCGATGTTCTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013539.1-894s21c1
Sequence:CCGGACACCCGGCTGGGTCAAATATCTCGAGATATTTGACCCAGCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013539.1-332s1c1
Sequence:CCGGGAGAACATCGATGTCAAGGAACTCGAGTTCCTTGACATCGATGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013539.1-824s1c1
Sequence:CCGGGAAAGAAGAGTGGAGGAACCACTCGAGTGGTTCCTCCACTCTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013539.1-328s1c1
Sequence:CCGGCTCCGAGAACATCGATGTCAACTCGAGTTGACATCGATGTTCTCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013539.1-901s1c1
Sequence:CCGGGCTGGGTCAAATATCCACTCTCTCGAGAGAGTGGATATTTGACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013539.1-940s1c1
Sequence:CCGGGAAGCGCTATCTGCTCTACAACTCGAGTTGTAGAGCAGATAGCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013539.1-1021s1c1
Sequence:CCGGGCTGGCCTAGACAACTTTAAACTCGAGTTTAAAGTTGTCTAGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013539.1-323s1c1
Sequence:CCGGGATTGCTCCGAGAACATCGATCTCGAGATCGATGTTCTCGGAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013539.1-589s1c1
Sequence:CCGGGTATCATCAGAGTAAGGGCCTCTCGAGAGGCCCTTACTCTGATGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks