EMAIL THIS PAGE TO A FRIEND

SPSB3

splA/ryanodine receptor domain and SOCS box containing 3

Synonyms: C16orf31 SSB3
Gene ID:
Mouse(79043) splA/ryanodine receptor domain and SOCS box containing 3
Rat(302981) splA/ryanodine receptor domain and SOCS box containing 3
chicken(416401) splA/ryanodine receptor domain and SOCS box containing 3
domestic cat(101086028) splA/ryanodine receptor domain and SOCS box containing 3
dog(490071) splA/ryanodine receptor domain and SOCS box containing 3
cow(515661) splA/ryanodine receptor domain and SOCS box containing 3
sheep(101111336) splA/ryanodine receptor domain and SOCS box containing 3
domestic guinea pig(100727903) splA/ryanodine receptor domain and SOCS box containing 3
naked mole-rat(101698123) splA/ryanodine receptor domain and SOCS box containing 3
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080861 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128291 MISSION® esiRNA esiRNA human SPSB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080861 Rosetta Predictions human pricing
NM_001106988 Rosetta Predictions rat pricing
NM_027141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171899 predicted 294
2 SASI_Hs01_00171900 predicted 596
3 SASI_Hs01_00171901 predicted 992
4 SASI_Hs01_00171902 predicted 960
5 SASI_Hs01_00171903 predicted 455
6 SASI_Hs01_00171905 predicted 406
7 SASI_Hs01_00171906 predicted 377
8 SASI_Hs02_00362635 predicted 532
9 SASI_Hs01_00171907 predicted 910
10 SASI_Hs01_00171908 predicted 453
11 SASI_Hs01_00171904 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224376 predicted 1043
2 SASI_Rn02_00224377 predicted 1075
3 SASI_Rn02_00224378 predicted 1678
4 SASI_Rn02_00224379 predicted 331
5 SASI_Rn02_00224380 predicted 1504
6 SASI_Rn02_00224381 predicted 1555
7 SASI_Rn02_00224382 predicted 1622
8 SASI_Rn02_00224383 predicted 361
9 SASI_Rn02_00224384 predicted 667
10 SASI_Rn02_00224385 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199167 predicted 1358
2 SASI_Mm01_00199168 predicted 460
3 SASI_Mm01_00199169 predicted 1244
4 SASI_Mm01_00199170 predicted 976
5 SASI_Mm02_00331640 predicted 845
6 SASI_Mm01_00199172 predicted 1308
7 SASI_Mm01_00199173 predicted 1345
8 SASI_Mm01_00199174 predicted 1402
9 SASI_Mm01_00199175 predicted 727
10 SASI_Mm02_00331641 predicted 756
11 SASI_Mm01_00199171 predicted 894
12 SASI_Mm01_00199176 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027141
SPSB3 MISSION shRNA Bacterial Glycerol Stock
splA/ryanodine receptor domain and SOCS box containing 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027141.1-77s1c1
Sequence:CCGGGCTTGATTGAGGTGCTCAGATCTCGAGATCTGAGCACCTCAATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027141.1-1032s1c1
Sequence:CCGGCCTCAAGCAAGTGCTGCATAACTCGAGTTATGCAGCACTTGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027141.1-1032s21c1
Sequence:CCGGCCTCAAGCAAGTGCTGCATAACTCGAGTTATGCAGCACTTGCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027141.1-138s21c1
Sequence:CCGGGAGTAGCAGGGCATGGCATTTCTCGAGAAATGCCATGCCCTGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027141.1-467s21c1
Sequence:CCGGCCTTGCTGAGCTGTGATAATCCTCGAGGATTATCACAGCTCAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027141.1-1344s21c1
Sequence:CCGGAGGGAAGCCGTACTCCTATTTCTCGAGAAATAGGAGTACGGCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027141.1-760s21c1
Sequence:CCGGTTTGGCCAGGGCTCCATTATTCTCGAGAATAATGGAGCCCTGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027141
SPSB3 MISSION shRNA shRNA Plasmid DNA
splA/ryanodine receptor domain and SOCS box containing 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027141.1-77s1c1
Sequence:CCGGGCTTGATTGAGGTGCTCAGATCTCGAGATCTGAGCACCTCAATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027141.1-1032s1c1
Sequence:CCGGCCTCAAGCAAGTGCTGCATAACTCGAGTTATGCAGCACTTGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027141.1-1032s21c1
Sequence:CCGGCCTCAAGCAAGTGCTGCATAACTCGAGTTATGCAGCACTTGCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027141.1-138s21c1
Sequence:CCGGGAGTAGCAGGGCATGGCATTTCTCGAGAAATGCCATGCCCTGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027141.1-467s21c1
Sequence:CCGGCCTTGCTGAGCTGTGATAATCCTCGAGGATTATCACAGCTCAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027141.1-1344s21c1
Sequence:CCGGAGGGAAGCCGTACTCCTATTTCTCGAGAAATAGGAGTACGGCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027141.1-760s21c1
Sequence:CCGGTTTGGCCAGGGCTCCATTATTCTCGAGAATAATGGAGCCCTGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027141
SPSB3 MISSION shRNA Lentiviral Transduction Particles
splA/ryanodine receptor domain and SOCS box containing 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027141.1-77s1c1
Sequence:CCGGGCTTGATTGAGGTGCTCAGATCTCGAGATCTGAGCACCTCAATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027141.1-1032s1c1
Sequence:CCGGCCTCAAGCAAGTGCTGCATAACTCGAGTTATGCAGCACTTGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027141.1-1032s21c1
Sequence:CCGGCCTCAAGCAAGTGCTGCATAACTCGAGTTATGCAGCACTTGCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027141.1-138s21c1
Sequence:CCGGGAGTAGCAGGGCATGGCATTTCTCGAGAAATGCCATGCCCTGCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027141.1-467s21c1
Sequence:CCGGCCTTGCTGAGCTGTGATAATCCTCGAGGATTATCACAGCTCAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027141.1-1344s21c1
Sequence:CCGGAGGGAAGCCGTACTCCTATTTCTCGAGAAATAGGAGTACGGCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027141.1-760s21c1
Sequence:CCGGTTTGGCCAGGGCTCCATTATTCTCGAGAATAATGGAGCCCTGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080861
VALIDATED
SPSB3 MISSION shRNA Bacterial Glycerol Stock
splA/ryanodine receptor domain and SOCS box containing 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080861.3-457s1c1
Sequence:CCGGCCGTAAGGTCAGCTTCCACATCTCGAGATGTGGAAGCTGACCTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080861.3-835s1c1
Sequence:CCGGGAACAAGAGATTCTACCCGATCTCGAGATCGGGTAGAATCTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-604s21c1
Sequence:CCGGGGATGTGGACCTGGACAAATACTCGAGTATTTGTCCAGGTCCACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-404s21c1
Sequence:CCGGTGGGTCTGGGATGACTTAAATCTCGAGATTTAAGTCATCCCAGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-1165s21c1
Sequence:CCGGTTCCCAGTGGAACTGCCTTCTCTCGAGAGAAGGCAGTTCCACTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-792s21c1
Sequence:CCGGTCAAGAACAGGAAGTGTATAGCTCGAGCTATACACTTCCTGTTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-378s21c1
Sequence:CCGGGCGGAGAGGAAGACGAGTATTCTCGAGAATACTCGTCTTCCTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080861
VALIDATED
SPSB3 MISSION shRNA shRNA Plasmid DNA
splA/ryanodine receptor domain and SOCS box containing 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080861.3-457s1c1
Sequence:CCGGCCGTAAGGTCAGCTTCCACATCTCGAGATGTGGAAGCTGACCTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080861.3-835s1c1
Sequence:CCGGGAACAAGAGATTCTACCCGATCTCGAGATCGGGTAGAATCTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-604s21c1
Sequence:CCGGGGATGTGGACCTGGACAAATACTCGAGTATTTGTCCAGGTCCACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-404s21c1
Sequence:CCGGTGGGTCTGGGATGACTTAAATCTCGAGATTTAAGTCATCCCAGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-1165s21c1
Sequence:CCGGTTCCCAGTGGAACTGCCTTCTCTCGAGAGAAGGCAGTTCCACTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-792s21c1
Sequence:CCGGTCAAGAACAGGAAGTGTATAGCTCGAGCTATACACTTCCTGTTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-378s21c1
Sequence:CCGGGCGGAGAGGAAGACGAGTATTCTCGAGAATACTCGTCTTCCTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080861
VALIDATED
SPSB3 MISSION shRNA Lentiviral Transduction Particles
splA/ryanodine receptor domain and SOCS box containing 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080861.3-457s1c1
Sequence:CCGGCCGTAAGGTCAGCTTCCACATCTCGAGATGTGGAAGCTGACCTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080861.3-835s1c1
Sequence:CCGGGAACAAGAGATTCTACCCGATCTCGAGATCGGGTAGAATCTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-604s21c1
Sequence:CCGGGGATGTGGACCTGGACAAATACTCGAGTATTTGTCCAGGTCCACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-404s21c1
Sequence:CCGGTGGGTCTGGGATGACTTAAATCTCGAGATTTAAGTCATCCCAGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-1165s21c1
Sequence:CCGGTTCCCAGTGGAACTGCCTTCTCTCGAGAGAAGGCAGTTCCACTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-792s21c1
Sequence:CCGGTCAAGAACAGGAAGTGTATAGCTCGAGCTATACACTTCCTGTTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_080861.3-378s21c1
Sequence:CCGGGCGGAGAGGAAGACGAGTATTCTCGAGAATACTCGTCTTCCTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks