EMAIL THIS PAGE TO A FRIEND

SPSB4

splA/ryanodine receptor domain and SOCS box containing 4

Synonyms: SSB-4 SSB4
UniProtKB ID: Q96A44
Gene ID:
Mouse(211949) splA/ryanodine receptor domain and SOCS box containing 4
Rat(300950) splA/ryanodine receptor domain and SOCS box containing 4
chicken(429129) splA/ryanodine receptor domain and SOCS box containing 4
dog(485691) splA/ryanodine receptor domain and SOCS box containing 4
domestic cat(101098572) splA/ryanodine receptor domain and SOCS box containing 4
naked mole-rat(101722907) splA/ryanodine receptor domain and SOCS box containing 4
domestic guinea pig(100734187) splA/ryanodine receptor domain and SOCS box containing 4
cow(512922) splA/ryanodine receptor domain and SOCS box containing 4
sheep(101108882) splA/ryanodine receptor domain and SOCS box containing 4
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA073015 Anti-SPSB4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080862 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080862 Rosetta Predictions human pricing
NM_001106849 Rosetta Predictions rat pricing
NM_145134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247534 predicted 817
2 SASI_Hs01_00247535 predicted 690
3 SASI_Hs01_00247536 predicted 1414
4 SASI_Hs01_00247537 predicted 436
5 SASI_Hs01_00247538 predicted 1351
6 SASI_Hs01_00247539 predicted 1183
7 SASI_Hs02_00362636 predicted 1082
8 SASI_Hs01_00247540 predicted 1380
9 SASI_Hs01_00247541 predicted 1222
10 SASI_Hs01_00247542 predicted 960
11 SASI_Hs01_00247543 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223006 predicted 1816
2 SASI_Rn02_00223007 predicted 1208
3 SASI_Rn02_00223008 predicted 1220
4 SASI_Rn02_00223009 predicted 1071
5 SASI_Rn02_00223010 predicted 1365
6 SASI_Rn02_00223011 predicted 1087
7 SASI_Rn02_00223012 predicted 1001
8 SASI_Rn02_00223013 predicted 812
9 SASI_Rn02_00223014 predicted 1724
10 SASI_Rn02_00223015 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038362 predicted 879
2 SASI_Mm01_00038363 predicted 815
3 SASI_Mm01_00038364 predicted 1311
4 SASI_Mm01_00038365 predicted 675
5 SASI_Mm01_00038366 predicted 1379
6 SASI_Mm01_00038367 predicted 964
7 SASI_Mm01_00038368 predicted 414
8 SASI_Mm01_00038370 predicted 499
9 SASI_Mm01_00038371 predicted 606
10 SASI_Mm02_00340521 predicted 838
11 SASI_Mm01_00038369 predicted 1195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080862
SPSB4 MISSION shRNA Bacterial Glycerol Stock
splA/ryanodine receptor domain and SOCS box containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080862.1-806s21c1
Sequence:CCGGTGAGGGCACACTCAGCTTCATCTCGAGATGAAGCTGAGTGTGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080862.1-438s21c1
Sequence:CCGGTCGCTCAACGTCTTCGTCAAGCTCGAGCTTGACGAAGACGTTGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080862.1-1225s21c1
Sequence:CCGGACCAACTTTGGAAACGAAAGGCTCGAGCCTTTCGTTTCCAAAGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080862.1-914s21c1
Sequence:CCGGTGAAGTCACCATGCGCTACATCTCGAGATGTAGCGCATGGTGACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2091s1c1
Sequence:CCGGGTGCTGTTTATTTATCAGCTTCTCGAGAAGCTGATAAATAAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2093s1c1
Sequence:CCGGGCTGTTTATTTATCAGCTTGACTCGAGTCAAGCTGATAAATAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2054s1c1
Sequence:CCGGCTACAAGTTTGTTTCCTGTTTCTCGAGAAACAGGAAACAAACTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166889    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-1502s1c1
Sequence:CCGGCCTCTGAATAATGAATGATGACTCGAGTCATCATTCATTATTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167160    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2057s1c1
Sequence:CCGGCAAGTTTGTTTCCTGTTTCAACTCGAGTTGAAACAGGAAACAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2232s1c1
Sequence:CCGGCCACCTCTTATATGTTTCAGACTCGAGTCTGAAACATATAAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080862
SPSB4 MISSION shRNA shRNA Plasmid DNA
splA/ryanodine receptor domain and SOCS box containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080862.1-806s21c1
Sequence:CCGGTGAGGGCACACTCAGCTTCATCTCGAGATGAAGCTGAGTGTGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080862.1-438s21c1
Sequence:CCGGTCGCTCAACGTCTTCGTCAAGCTCGAGCTTGACGAAGACGTTGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080862.1-1225s21c1
Sequence:CCGGACCAACTTTGGAAACGAAAGGCTCGAGCCTTTCGTTTCCAAAGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080862.1-914s21c1
Sequence:CCGGTGAAGTCACCATGCGCTACATCTCGAGATGTAGCGCATGGTGACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2091s1c1
Sequence:CCGGGTGCTGTTTATTTATCAGCTTCTCGAGAAGCTGATAAATAAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2093s1c1
Sequence:CCGGGCTGTTTATTTATCAGCTTGACTCGAGTCAAGCTGATAAATAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2054s1c1
Sequence:CCGGCTACAAGTTTGTTTCCTGTTTCTCGAGAAACAGGAAACAAACTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166889    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-1502s1c1
Sequence:CCGGCCTCTGAATAATGAATGATGACTCGAGTCATCATTCATTATTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167160    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2057s1c1
Sequence:CCGGCAAGTTTGTTTCCTGTTTCAACTCGAGTTGAAACAGGAAACAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2232s1c1
Sequence:CCGGCCACCTCTTATATGTTTCAGACTCGAGTCTGAAACATATAAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080862
SPSB4 MISSION shRNA Lentiviral Transduction Particles
splA/ryanodine receptor domain and SOCS box containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080862.1-806s21c1
Sequence:CCGGTGAGGGCACACTCAGCTTCATCTCGAGATGAAGCTGAGTGTGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080862.1-438s21c1
Sequence:CCGGTCGCTCAACGTCTTCGTCAAGCTCGAGCTTGACGAAGACGTTGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080862.1-1225s21c1
Sequence:CCGGACCAACTTTGGAAACGAAAGGCTCGAGCCTTTCGTTTCCAAAGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080862.1-914s21c1
Sequence:CCGGTGAAGTCACCATGCGCTACATCTCGAGATGTAGCGCATGGTGACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167766    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2091s1c1
Sequence:CCGGGTGCTGTTTATTTATCAGCTTCTCGAGAAGCTGATAAATAAACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167420    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2093s1c1
Sequence:CCGGGCTGTTTATTTATCAGCTTGACTCGAGTCAAGCTGATAAATAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2054s1c1
Sequence:CCGGCTACAAGTTTGTTTCCTGTTTCTCGAGAAACAGGAAACAAACTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166889    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-1502s1c1
Sequence:CCGGCCTCTGAATAATGAATGATGACTCGAGTCATCATTCATTATTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167160    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2057s1c1
Sequence:CCGGCAAGTTTGTTTCCTGTTTCAACTCGAGTTGAAACAGGAAACAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080862.1-2232s1c1
Sequence:CCGGCCACCTCTTATATGTTTCAGACTCGAGTCTGAAACATATAAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145134
VALIDATED
SPSB4 MISSION shRNA Bacterial Glycerol Stock
splA/ryanodine receptor domain and SOCS box containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145134.3-494s21c1
Sequence:CCGGACCGCTCCCTCAATGTCTTTGCTCGAGCAAAGACATTGAGGGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145134.3-975s21c1
Sequence:CCGGCGAAGTCACCATGCGCTACATCTCGAGATGTAGCGCATGGTGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145134.3-822s21c1
Sequence:CCGGAGCCTTTGCTCTGCCAGATTCCTCGAGGAATCTGGCAGAGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145134.3-1970s21c1
Sequence:CCGGGACTGCAAAGGTGGGTATAACCTCGAGGTTATACCCACCTTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145134.3-925s21c1
Sequence:CCGGCTCAAGGGCAAGAAACTATACCTCGAGGTATAGTTTCTTGCCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145134
VALIDATED
SPSB4 MISSION shRNA shRNA Plasmid DNA
splA/ryanodine receptor domain and SOCS box containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145134.3-494s21c1
Sequence:CCGGACCGCTCCCTCAATGTCTTTGCTCGAGCAAAGACATTGAGGGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145134.3-975s21c1
Sequence:CCGGCGAAGTCACCATGCGCTACATCTCGAGATGTAGCGCATGGTGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145134.3-822s21c1
Sequence:CCGGAGCCTTTGCTCTGCCAGATTCCTCGAGGAATCTGGCAGAGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145134.3-1970s21c1
Sequence:CCGGGACTGCAAAGGTGGGTATAACCTCGAGGTTATACCCACCTTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145134.3-925s21c1
Sequence:CCGGCTCAAGGGCAAGAAACTATACCTCGAGGTATAGTTTCTTGCCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145134
VALIDATED
SPSB4 MISSION shRNA Lentiviral Transduction Particles
splA/ryanodine receptor domain and SOCS box containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145134.3-494s21c1
Sequence:CCGGACCGCTCCCTCAATGTCTTTGCTCGAGCAAAGACATTGAGGGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145134.3-975s21c1
Sequence:CCGGCGAAGTCACCATGCGCTACATCTCGAGATGTAGCGCATGGTGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145134.3-822s21c1
Sequence:CCGGAGCCTTTGCTCTGCCAGATTCCTCGAGGAATCTGGCAGAGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145134.3-1970s21c1
Sequence:CCGGGACTGCAAAGGTGGGTATAACCTCGAGGTTATACCCACCTTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145134.3-925s21c1
Sequence:CCGGCTCAAGGGCAAGAAACTATACCTCGAGGTATAGTTTCTTGCCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks