EMAIL THIS PAGE TO A FRIEND

SPTA1

spectrin, alpha, erythrocytic 1 (elliptocytosis 2)

Synonyms: EL2 HPP HS3 SPH3 SPTA
UniProtKB ID: P02549, Q15514, Q5VYL1, Q5VYL2, Q6LDY5
Gene ID:
Human(6708) Summary: Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
Mouse(20739) spectrin alpha, erythrocytic 1
Rat(289257) spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
domestic cat(101097298) spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
Horse(100056575) spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
dog(488616) spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
domestic guinea pig(100722803) spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
naked mole-rat(101706547) spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
cow(505122) spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
sheep(101112688) spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
Gene Class: Cytoskeleton
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003126 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056051 MISSION® esiRNA esiRNA human SPTA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003126 Rosetta Predictions human pricing
NM_001011908 Rosetta Predictions rat pricing
NM_011465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335110 predicted 4886
2 SASI_Hs01_00148926 predicted 5155
3 SASI_Hs01_00148927 predicted 3059
4 SASI_Hs01_00148928 predicted 3423
5 SASI_Hs01_00148929 predicted 1460
6 SASI_Hs01_00148930 predicted 6547
7 SASI_Hs02_00335111 predicted 853
8 SASI_Hs01_00148933 predicted 1806
9 SASI_Hs01_00148934 predicted 4152
10 SASI_Hs02_00335112 predicted 3266
11 SASI_Hs01_00148925 predicted 3891
12 SASI_Hs01_00148931 predicted 5964
13 SASI_Hs01_00148932 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084129 predicted 6474
2 SASI_Rn01_00084130 predicted 410
3 SASI_Rn01_00084131 predicted 7075
4 SASI_Rn01_00084132 predicted 820
5 SASI_Rn01_00084133 predicted 3993
6 SASI_Rn02_00199899 predicted 6454
7 SASI_Rn01_00084134 predicted 4062
8 SASI_Rn01_00084136 predicted 4268
9 SASI_Rn02_00199900 predicted 3163
10 SASI_Rn01_00084137 predicted 3261
11 SASI_Rn01_00084128 predicted 2703
12 SASI_Rn01_00084135 predicted 6419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088783 predicted 4166
2 SASI_Mm01_00088784 predicted 3890
3 SASI_Mm01_00088785 predicted 4094
4 SASI_Mm01_00088786 predicted 3446
5 SASI_Mm01_00088787 predicted 1323
6 SASI_Mm01_00088788 predicted 1964
7 SASI_Mm01_00088789 predicted 2371
8 SASI_Mm01_00088790 predicted 2592
9 SASI_Mm01_00088791 predicted 4104
10 SASI_Mm01_00088792 predicted 3665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003126
SPTA1 MISSION shRNA Bacterial Glycerol Stock
spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003126.2-3427s21c1
Sequence:CCGGTCGTCTATTGCAACGTTATAACTCGAGTTATAACGTTGCAATAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003126.2-7442s21c1
Sequence:CCGGTCCTACTTTGGCAACTAATAACTCGAGTTATTAGTTGCCAAAGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003126.2-550s21c1
Sequence:CCGGACGATTTACCATGGGTCATTCCTCGAGGAATGACCCATGGTAAATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-1514s1c1
Sequence:CCGGCCTCTGATGAAGTTCGGGAAACTCGAGTTTCCCGAACTTCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-2457s1c1
Sequence:CCGGCCATCCTGATTCTAAGGATATCTCGAGATATCCTTAGAATCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-6530s1c1
Sequence:CCGGCCAGCCCTTATACCTGGTTAACTCGAGTTAACCAGGTATAAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-4138s1c1
Sequence:CCGGGCCGAAGACTTAACTGGCATACTCGAGTATGCCAGTTAAGTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-4753s1c1
Sequence:CCGGGCCTGTGATGAATCCTACAAACTCGAGTTTGTAGGATTCATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003126
SPTA1 MISSION shRNA shRNA Plasmid DNA
spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003126.2-3427s21c1
Sequence:CCGGTCGTCTATTGCAACGTTATAACTCGAGTTATAACGTTGCAATAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003126.2-7442s21c1
Sequence:CCGGTCCTACTTTGGCAACTAATAACTCGAGTTATTAGTTGCCAAAGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003126.2-550s21c1
Sequence:CCGGACGATTTACCATGGGTCATTCCTCGAGGAATGACCCATGGTAAATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-1514s1c1
Sequence:CCGGCCTCTGATGAAGTTCGGGAAACTCGAGTTTCCCGAACTTCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-2457s1c1
Sequence:CCGGCCATCCTGATTCTAAGGATATCTCGAGATATCCTTAGAATCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-6530s1c1
Sequence:CCGGCCAGCCCTTATACCTGGTTAACTCGAGTTAACCAGGTATAAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-4138s1c1
Sequence:CCGGGCCGAAGACTTAACTGGCATACTCGAGTATGCCAGTTAAGTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-4753s1c1
Sequence:CCGGGCCTGTGATGAATCCTACAAACTCGAGTTTGTAGGATTCATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003126
SPTA1 MISSION shRNA Lentiviral Transduction Particles
spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003126.2-3427s21c1
Sequence:CCGGTCGTCTATTGCAACGTTATAACTCGAGTTATAACGTTGCAATAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003126.2-7442s21c1
Sequence:CCGGTCCTACTTTGGCAACTAATAACTCGAGTTATTAGTTGCCAAAGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003126.2-550s21c1
Sequence:CCGGACGATTTACCATGGGTCATTCCTCGAGGAATGACCCATGGTAAATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-1514s1c1
Sequence:CCGGCCTCTGATGAAGTTCGGGAAACTCGAGTTTCCCGAACTTCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-2457s1c1
Sequence:CCGGCCATCCTGATTCTAAGGATATCTCGAGATATCCTTAGAATCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-6530s1c1
Sequence:CCGGCCAGCCCTTATACCTGGTTAACTCGAGTTAACCAGGTATAAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-4138s1c1
Sequence:CCGGGCCGAAGACTTAACTGGCATACTCGAGTATGCCAGTTAAGTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003126.1-4753s1c1
Sequence:CCGGGCCTGTGATGAATCCTACAAACTCGAGTTTGTAGGATTCATCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011465
SPTA1 MISSION shRNA Bacterial Glycerol Stock
spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-4658s1c1
Sequence:CCGGCCCACTAACATTCAGAGGAAACTCGAGTTTCCTCTGAATGTTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-1187s1c1
Sequence:CCGGCGGTTCTTATCTGACTATGATCTCGAGATCATAGTCAGATAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-2191s1c1
Sequence:CCGGGCAGGTTACCTCTGAGGATTACTCGAGTAATCCTCAGAGGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-6514s1c1
Sequence:CCGGGCAGATCAAGAACTTTGAAATCTCGAGATTTCAAAGTTCTTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-4144s1c1
Sequence:CCGGCCACCGTAACAGACGTGAAATCTCGAGATTTCACGTCTGTTACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011465
SPTA1 MISSION shRNA shRNA Plasmid DNA
spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-4658s1c1
Sequence:CCGGCCCACTAACATTCAGAGGAAACTCGAGTTTCCTCTGAATGTTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-1187s1c1
Sequence:CCGGCGGTTCTTATCTGACTATGATCTCGAGATCATAGTCAGATAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-2191s1c1
Sequence:CCGGGCAGGTTACCTCTGAGGATTACTCGAGTAATCCTCAGAGGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-6514s1c1
Sequence:CCGGGCAGATCAAGAACTTTGAAATCTCGAGATTTCAAAGTTCTTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-4144s1c1
Sequence:CCGGCCACCGTAACAGACGTGAAATCTCGAGATTTCACGTCTGTTACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011465
SPTA1 MISSION shRNA Lentiviral Transduction Particles
spectrin, alpha, erythrocytic 1 (elliptocytosis 2)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-4658s1c1
Sequence:CCGGCCCACTAACATTCAGAGGAAACTCGAGTTTCCTCTGAATGTTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-1187s1c1
Sequence:CCGGCGGTTCTTATCTGACTATGATCTCGAGATCATAGTCAGATAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-2191s1c1
Sequence:CCGGGCAGGTTACCTCTGAGGATTACTCGAGTAATCCTCAGAGGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-6514s1c1
Sequence:CCGGGCAGATCAAGAACTTTGAAATCTCGAGATTTCAAAGTTCTTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011465.2-4144s1c1
Sequence:CCGGCCACCGTAACAGACGTGAAATCTCGAGATTTCACGTCTGTTACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks