EMAIL THIS PAGE TO A FRIEND

SPTAN1

spectrin, alpha, non-erythrocytic 1

Synonyms: EIEE5 NEAS SPTA2
Gene ID:
Human(6709) Summary: Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
Mouse(20740) spectrin alpha, non-erythrocytic 1
Rat(64159) spectrin, alpha, non-erythrocytic 1
cow(540108) spectrin, alpha, non-erythrocytic 1
sheep(101107431) spectrin, alpha, non-erythrocytic 1
naked mole-rat(101701130) spectrin, alpha, non-erythrocytic 1
Domestic Rabbit(100350866) spectrin, alpha, non-erythrocytic 1
domestic guinea pig(100715698) spectrin, alpha, non-erythrocytic 1
chicken(374234) spectrin, alpha, non-erythrocytic 1 (alpha-fodrin)
domestic cat(101080748) spectrin, alpha, non-erythrocytic 1
Horse(100066945) spectrin, alpha, non-erythrocytic 1
dog(403484) spectrin, alpha, non-erythrocytic 1
Gene Class: Cytoskeleton
289 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003127 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093741 MISSION® esiRNA esiRNA human SPTAN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003127 Rosetta Predictions human pricing
NM_171983 Rosetta Predictions rat pricing
NM_001076554 Rosetta Predictions mouse pricing
XM_988241 Rosetta Predictions mouse pricing
XM_988286 Rosetta Predictions mouse pricing
XM_988316 Rosetta Predictions mouse pricing
XM_988350 Rosetta Predictions mouse pricing
XM_988383 Rosetta Predictions mouse pricing
XM_988430 Rosetta Predictions mouse pricing
XM_988464 Rosetta Predictions mouse pricing
XM_988500 Rosetta Predictions mouse pricing
XM_988540 Rosetta Predictions mouse pricing
XM_988572 Rosetta Predictions mouse pricing
XM_988611 Rosetta Predictions mouse pricing
XM_988646 Rosetta Predictions mouse pricing
XM_988679 Rosetta Predictions mouse pricing
XM_988717 Rosetta Predictions mouse pricing
XM_988759 Rosetta Predictions mouse pricing
XM_988794 Rosetta Predictions mouse pricing
XM_988826 Rosetta Predictions mouse pricing
XM_988865 Rosetta Predictions mouse pricing
XM_988906 Rosetta Predictions mouse pricing
XM_988935 Rosetta Predictions mouse pricing
XM_988976 Rosetta Predictions mouse pricing
XM_989012 Rosetta Predictions mouse pricing
XM_989055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335113 predicted 3973
2 SASI_Hs01_00136744 predicted 3255
3 SASI_Hs02_00335114 predicted 7618
4 SASI_Hs01_00136746 predicted 2205
5 SASI_Hs01_00136748 predicted 5591
6 SASI_Hs01_00136749 predicted 2813
7 SASI_Hs01_00136750 predicted 3408
8 SASI_Hs01_00136751 predicted 3275
9 SASI_Hs02_00335115 predicted 3294
10 SASI_Hs02_00335116 predicted 5331
11 SASI_Hs01_00136745 predicted 4564
12 SASI_Hs01_00136747 predicted 2832
13 SASI_Hs01_00136752 predicted 691
14 SASI_Hs01_00136753 predicted 5484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048159 predicted 4789
2 SASI_Rn01_00048162 predicted 4172
3 SASI_Rn01_00048163 predicted 7406
4 SASI_Rn01_00048165 predicted 6330
5 SASI_Rn02_00269078 predicted 3962
6 SASI_Rn01_00048166 predicted 6642
7 SASI_Rn02_00269079 predicted 3444
8 SASI_Rn01_00048168 predicted 217
9 SASI_Rn02_00269080 predicted 4670
10 SASI_Rn02_00269081 predicted 2839
11 SASI_Rn01_00048160 predicted 2521
12 SASI_Rn01_00048161 predicted 2305
13 SASI_Rn01_00048164 predicted 3294
14 SASI_Rn01_00048167 predicted 2785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292309 predicted 1000
2 SASI_Mm02_00292310 predicted 4229
3 SASI_Mm02_00292311 predicted 4629
4 SASI_Mm02_00292312 predicted 2159
5 SASI_Mm02_00292313 predicted 578
6 SASI_Mm02_00292314 predicted 2636
7 SASI_Mm02_00292315 predicted 7307
8 SASI_Mm02_00292316 predicted 2134
9 SASI_Mm02_00292317 predicted 2178
10 SASI_Mm02_00292318 predicted 6391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272793 predicted 958
2 SASI_Mm01_00272794 predicted 1007
3 SASI_Mm01_00272795 predicted 841
4 SASI_Mm01_00272796 predicted 448
5 SASI_Mm01_00272797 predicted 432
6 SASI_Mm01_00272798 predicted 817
7 SASI_Mm01_00272799 predicted 944
8 SASI_Mm01_00272800 predicted 578
9 SASI_Mm01_00272801 predicted 571
10 SASI_Mm01_00272802 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238450 predicted 1004
2 SASI_Mm01_00238451 predicted 844
3 SASI_Mm01_00238452 predicted 450
4 SASI_Mm01_00238453 predicted 431
5 SASI_Mm01_00238454 predicted 2164
6 SASI_Mm01_00238455 predicted 1941
7 SASI_Mm01_00238456 predicted 580
8 SASI_Mm01_00238457 predicted 2277
9 SASI_Mm01_00238458 predicted 2106
10 SASI_Mm01_00238459 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279704 predicted 1002
2 SASI_Mm01_00279705 predicted 843
3 SASI_Mm01_00279706 predicted 4239
4 SASI_Mm01_00279707 predicted 4635
5 SASI_Mm01_00279708 predicted 2164
6 SASI_Mm01_00279709 predicted 576
7 SASI_Mm01_00279710 predicted 3206
8 SASI_Mm01_00279711 predicted 6363
9 SASI_Mm01_00279712 predicted 2636
10 SASI_Mm01_00279713 predicted 4913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211777 predicted 272
2 SASI_Mm01_00211778 predicted 205
3 SASI_Mm01_00211779 predicted 290
4 SASI_Mm01_00211780 predicted 273
5 SASI_Mm01_00211781 predicted 239
6 SASI_Mm01_00211782 predicted 238
7 SASI_Mm01_00211783 predicted 234
8 SASI_Mm01_00211784 predicted 278
9 SASI_Mm01_00211785 predicted 257
10 SASI_Mm01_00211786 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267939 predicted 609
2 SASI_Mm01_00267940 predicted 533
3 SASI_Mm01_00267941 predicted 625
4 SASI_Mm01_00267942 predicted 673
5 SASI_Mm01_00267943 predicted 404
6 SASI_Mm01_00267944 predicted 752
7 SASI_Mm01_00267945 predicted 679
8 SASI_Mm01_00267946 predicted 779
9 SASI_Mm01_00267947 predicted 592
10 SASI_Mm01_00267948 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203943 predicted 839
2 SASI_Mm01_00203944 predicted 570
3 SASI_Mm01_00203945 predicted 415
4 SASI_Mm01_00203946 predicted 801
5 SASI_Mm01_00203947 predicted 459
6 SASI_Mm01_00203948 predicted 479
7 SASI_Mm01_00203949 predicted 514
8 SASI_Mm01_00203950 predicted 954
9 SASI_Mm01_00203951 predicted 547
10 SASI_Mm01_00203952 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258534 predicted 568
2 SASI_Mm01_00258535 predicted 1196
3 SASI_Mm01_00258536 predicted 1120
4 SASI_Mm01_00258537 predicted 1341
5 SASI_Mm01_00258538 predicted 878
6 SASI_Mm01_00258539 predicted 927
7 SASI_Mm01_00258540 predicted 1369
8 SASI_Mm01_00258541 predicted 1269
9 SASI_Mm01_00258542 predicted 944
10 SASI_Mm01_00258543 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215577 predicted 2108
2 SASI_Mm01_00215578 predicted 1839
3 SASI_Mm01_00215579 predicted 2056
4 SASI_Mm01_00215580 predicted 1722
5 SASI_Mm01_00215581 predicted 775
6 SASI_Mm01_00215582 predicted 762
7 SASI_Mm01_00215583 predicted 1771
8 SASI_Mm01_00215584 predicted 2122
9 SASI_Mm01_00215585 predicted 903
10 SASI_Mm01_00215586 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277203 predicted 2349
2 SASI_Mm01_00277204 predicted 2080
3 SASI_Mm01_00277205 predicted 2303
4 SASI_Mm01_00277206 predicted 1969
5 SASI_Mm01_00277207 predicted 1010
6 SASI_Mm01_00277208 predicted 1006
7 SASI_Mm01_00277209 predicted 2019
8 SASI_Mm01_00277210 predicted 2361
9 SASI_Mm01_00277211 predicted 1153
10 SASI_Mm01_00277212 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264595 predicted 1827
2 SASI_Mm01_00264596 predicted 1561
3 SASI_Mm01_00264597 predicted 1781
4 SASI_Mm01_00264598 predicted 1453
5 SASI_Mm01_00264599 predicted 497
6 SASI_Mm01_00264600 predicted 485
7 SASI_Mm01_00264601 predicted 1495
8 SASI_Mm01_00264602 predicted 1843
9 SASI_Mm01_00264603 predicted 594
10 SASI_Mm01_00264604 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232306 predicted 1010
2 SASI_Mm01_00232307 predicted 837
3 SASI_Mm01_00232308 predicted 4235
4 SASI_Mm01_00232309 predicted 4635
5 SASI_Mm01_00232310 predicted 2173
6 SASI_Mm01_00232311 predicted 583
7 SASI_Mm01_00232312 predicted 3202
8 SASI_Mm01_00232313 predicted 2644
9 SASI_Mm01_00232314 predicted 4918
10 SASI_Mm01_00232315 predicted 3945
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244119 predicted 1009
2 SASI_Mm01_00244120 predicted 4126
3 SASI_Mm01_00244121 predicted 4527
4 SASI_Mm01_00244122 predicted 2171
5 SASI_Mm01_00244123 predicted 586
6 SASI_Mm01_00244124 predicted 2646
7 SASI_Mm01_00244125 predicted 7036
8 SASI_Mm01_00244126 predicted 3836
9 SASI_Mm01_00244127 predicted 2178
10 SASI_Mm01_00244128 predicted 6266
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252504 predicted 944
2 SASI_Mm01_00252505 predicted 2374
3 SASI_Mm01_00252506 predicted 1336
4 SASI_Mm01_00252507 predicted 2238
5 SASI_Mm01_00252508 predicted 730
6 SASI_Mm01_00252509 predicted 3961
7 SASI_Mm01_00252510 predicted 1619
8 SASI_Mm01_00252511 predicted 2662
9 SASI_Mm01_00252512 predicted 4004
10 SASI_Mm01_00252513 predicted 4353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221824 predicted 1006
2 SASI_Mm01_00221825 predicted 4128
3 SASI_Mm01_00221826 predicted 4530
4 SASI_Mm01_00221827 predicted 2170
5 SASI_Mm01_00221828 predicted 583
6 SASI_Mm01_00221829 predicted 2645
7 SASI_Mm01_00221830 predicted 7130
8 SASI_Mm01_00221831 predicted 3833
9 SASI_Mm01_00221832 predicted 2180
10 SASI_Mm01_00221833 predicted 6272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269149 predicted 1002
2 SASI_Mm01_00269150 predicted 4124
3 SASI_Mm01_00269151 predicted 4520
4 SASI_Mm01_00269152 predicted 2170
5 SASI_Mm01_00269153 predicted 576
6 SASI_Mm01_00269154 predicted 2645
7 SASI_Mm01_00269155 predicted 7130
8 SASI_Mm01_00269156 predicted 3830
9 SASI_Mm01_00269157 predicted 2182
10 SASI_Mm01_00269158 predicted 6273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273791 predicted 1785
2 SASI_Mm01_00273792 predicted 3209
3 SASI_Mm01_00273793 predicted 2188
4 SASI_Mm01_00273794 predicted 3081
5 SASI_Mm01_00273795 predicted 1571
6 SASI_Mm01_00273796 predicted 4798
7 SASI_Mm01_00273797 predicted 2468
8 SASI_Mm01_00273798 predicted 3512
9 SASI_Mm01_00273799 predicted 4850
10 SASI_Mm01_00273800 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236269 predicted 1008
2 SASI_Mm01_00236270 predicted 4140
3 SASI_Mm01_00236271 predicted 4530
4 SASI_Mm01_00236272 predicted 2165
5 SASI_Mm01_00236273 predicted 580
6 SASI_Mm01_00236274 predicted 2643
7 SASI_Mm01_00236275 predicted 7118
8 SASI_Mm01_00236276 predicted 3840
9 SASI_Mm01_00236277 predicted 2176
10 SASI_Mm01_00236278 predicted 6272
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270076 predicted 2170
2 SASI_Mm01_00270077 predicted 3605
3 SASI_Mm01_00270078 predicted 2569
4 SASI_Mm01_00270079 predicted 3462
5 SASI_Mm01_00270080 predicted 1965
6 SASI_Mm01_00270081 predicted 5190
7 SASI_Mm01_00270082 predicted 2857
8 SASI_Mm01_00270083 predicted 3890
9 SASI_Mm01_00270084 predicted 5233
10 SASI_Mm01_00270085 predicted 1884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239669 predicted 1008
2 SASI_Mm01_00239670 predicted 4131
3 SASI_Mm01_00239671 predicted 4524
4 SASI_Mm01_00239672 predicted 2169
5 SASI_Mm01_00239673 predicted 582
6 SASI_Mm01_00239674 predicted 2644
7 SASI_Mm01_00239675 predicted 7135
8 SASI_Mm01_00239676 predicted 3835
9 SASI_Mm01_00239677 predicted 2182
10 SASI_Mm01_00239678 predicted 6278
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220057 predicted 933
2 SASI_Mm01_00220058 predicted 4232
3 SASI_Mm01_00220059 predicted 4624
4 SASI_Mm01_00220060 predicted 2102
5 SASI_Mm01_00220061 predicted 505
6 SASI_Mm01_00220062 predicted 2567
7 SASI_Mm01_00220063 predicted 7228
8 SASI_Mm01_00220064 predicted 3324
9 SASI_Mm01_00220065 predicted 3934
10 SASI_Mm01_00220066 predicted 2114
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250555 predicted 1002
2 SASI_Mm01_00250556 predicted 4234
3 SASI_Mm01_00250557 predicted 4632
4 SASI_Mm01_00250558 predicted 2166
5 SASI_Mm01_00250559 predicted 579
6 SASI_Mm01_00250560 predicted 2637
7 SASI_Mm01_00250561 predicted 7313
8 SASI_Mm01_00250562 predicted 3949
9 SASI_Mm01_00250563 predicted 2183
10 SASI_Mm01_00250564 predicted 6388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272447 predicted 1008
2 SASI_Mm01_00272448 predicted 4300
3 SASI_Mm01_00272449 predicted 4691
4 SASI_Mm01_00272450 predicted 2167
5 SASI_Mm01_00272451 predicted 582
6 SASI_Mm01_00272452 predicted 2640
7 SASI_Mm01_00272453 predicted 7294
8 SASI_Mm01_00272454 predicted 3398
9 SASI_Mm01_00272455 predicted 4001
10 SASI_Mm01_00272456 predicted 2182
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227035 predicted 1008
2 SASI_Mm01_00227036 predicted 4240
3 SASI_Mm01_00227037 predicted 4638
4 SASI_Mm01_00227038 predicted 2164
5 SASI_Mm01_00227039 predicted 580
6 SASI_Mm01_00227040 predicted 2640
7 SASI_Mm01_00227041 predicted 7252
8 SASI_Mm01_00227042 predicted 3942
9 SASI_Mm01_00227043 predicted 2184
10 SASI_Mm01_00227044 predicted 6397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003127
VALIDATED
SPTAN1 MISSION shRNA Bacterial Glycerol Stock
spectrin, alpha, non-erythrocytic 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003127.1-1336s1c1
Sequence:CCGGGCCCATGAAGACAGCTTCAAACTCGAGTTTGAAGCTGTCTTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003127.1-394s1c1
Sequence:CCGGGCCATTGTTAAGCTGGATGAACTCGAGTTCATCCAGCTTAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003127.1-5905s1c1
Sequence:CCGGGACCTCATTAAGAAGAACAATCTCGAGATTGTTCTTCTTAATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003127.1-2098s1c1
Sequence:CCGGGCCACTGAACTGAAAGGAATACTCGAGTATTCCTTTCAGTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003127.2-1347s21c1
Sequence:CCGGGCCCATGAAGACAGCTTCAAACTCGAGTTTGAAGCTGTCTTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003127.2-2109s21c1
Sequence:CCGGGCCACTGAACTGAAAGGAATACTCGAGTATTCCTTTCAGTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003127.2-405s21c1
Sequence:CCGGGCCATTGTTAAGCTGGATGAACTCGAGTTCATCCAGCTTAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003127.2-3876s21c1
Sequence:CCGGGCTCTAAACACAGACAATTATCTCGAGATAATTGTCTGTGTTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003127
VALIDATED
SPTAN1 MISSION shRNA shRNA Plasmid DNA
spectrin, alpha, non-erythrocytic 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003127.1-1336s1c1
Sequence:CCGGGCCCATGAAGACAGCTTCAAACTCGAGTTTGAAGCTGTCTTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003127.1-394s1c1
Sequence:CCGGGCCATTGTTAAGCTGGATGAACTCGAGTTCATCCAGCTTAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003127.1-5905s1c1
Sequence:CCGGGACCTCATTAAGAAGAACAATCTCGAGATTGTTCTTCTTAATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003127.1-2098s1c1
Sequence:CCGGGCCACTGAACTGAAAGGAATACTCGAGTATTCCTTTCAGTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003127.2-1347s21c1
Sequence:CCGGGCCCATGAAGACAGCTTCAAACTCGAGTTTGAAGCTGTCTTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003127.2-2109s21c1
Sequence:CCGGGCCACTGAACTGAAAGGAATACTCGAGTATTCCTTTCAGTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003127.2-405s21c1
Sequence:CCGGGCCATTGTTAAGCTGGATGAACTCGAGTTCATCCAGCTTAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003127.2-3876s21c1
Sequence:CCGGGCTCTAAACACAGACAATTATCTCGAGATAATTGTCTGTGTTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003127
VALIDATED
SPTAN1 MISSION shRNA Lentiviral Transduction Particles
spectrin, alpha, non-erythrocytic 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003127.1-1336s1c1
Sequence:CCGGGCCCATGAAGACAGCTTCAAACTCGAGTTTGAAGCTGTCTTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003127.1-394s1c1
Sequence:CCGGGCCATTGTTAAGCTGGATGAACTCGAGTTCATCCAGCTTAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003127.1-5905s1c1
Sequence:CCGGGACCTCATTAAGAAGAACAATCTCGAGATTGTTCTTCTTAATGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003127.1-2098s1c1
Sequence:CCGGGCCACTGAACTGAAAGGAATACTCGAGTATTCCTTTCAGTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003127.2-1347s21c1
Sequence:CCGGGCCCATGAAGACAGCTTCAAACTCGAGTTTGAAGCTGTCTTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003127.2-2109s21c1
Sequence:CCGGGCCACTGAACTGAAAGGAATACTCGAGTATTCCTTTCAGTTCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003127.2-405s21c1
Sequence:CCGGGCCATTGTTAAGCTGGATGAACTCGAGTTCATCCAGCTTAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003127.2-3876s21c1
Sequence:CCGGGCTCTAAACACAGACAATTATCTCGAGATAATTGTCTGTGTTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks