EMAIL THIS PAGE TO A FRIEND

SPTB

spectrin, beta, erythrocytic

Synonyms: EL3 HS2 HSPTB1 SPH2
UniProtKB ID: P11277, Q15510, Q15519
Gene ID:
Human(6710) Summary: This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
Mouse(20741) spectrin beta, erythrocytic
Rat(314251) spectrin, beta, erythrocytic
Zebrafish(58040) spectrin, beta, erythrocytic
Horse(100052369) spectrin, beta, erythrocytic
domestic cat(101088497) spectrin, beta, erythrocytic
dog(490734) spectrin, beta, erythrocytic
chicken(769410) spectrin, beta, erythrocytic
domestic guinea pig(100714128) spectrin, beta, erythrocytic
Domestic Rabbit(100355750) spectrin, beta, erythrocytic
naked mole-rat(101704610) spectrin, beta, erythrocytic
cow(527711) spectrin, beta, erythrocytic
sheep(101120414) spectrin, beta, erythrocytic
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000347 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000347 Rosetta Predictions human pricing
NM_001024858 Rosetta Predictions human pricing
NM_212522 Rosetta Predictions rat pricing
NM_013675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106207 predicted 3142
2 SASI_Hs01_00106208 predicted 4504
3 SASI_Hs01_00106209 predicted 4086
4 SASI_Hs01_00106210 predicted 810
5 SASI_Hs01_00106212 predicted 4566
6 SASI_Hs01_00106213 predicted 4408
7 SASI_Hs01_00106214 predicted 845
8 SASI_Hs02_00302382 predicted 1127
9 SASI_Hs01_00106215 predicted 2766
10 SASI_Hs01_00106216 predicted 4621
11 SASI_Hs01_00106211 predicted 2753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017734 predicted 3139
2 SASI_Hs01_00017735 predicted 4504
3 SASI_Hs01_00017736 predicted 4081
4 SASI_Hs01_00017737 predicted 808
5 SASI_Hs01_00017739 predicted 4564
6 SASI_Hs01_00017740 predicted 4400
7 SASI_Hs01_00017741 predicted 853
8 SASI_Hs02_00307256 predicted 1133
9 SASI_Hs01_00017742 predicted 2769
10 SASI_Hs01_00017743 predicted 4625
11 SASI_Hs01_00017738 predicted 2755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089621 predicted 4655
2 SASI_Rn02_00270545 predicted 5386
3 SASI_Rn01_00089623 predicted 4376
4 SASI_Rn02_00270546 predicted 1256
5 SASI_Rn01_00089624 predicted 4660
6 SASI_Rn01_00089625 predicted 1756
7 SASI_Rn01_00089626 predicted 832
8 SASI_Rn01_00089628 predicted 3831
9 SASI_Rn01_00089629 predicted 6071
10 SASI_Rn01_00089630 predicted 5314
11 SASI_Rn01_00089622 predicted 4083
12 SASI_Rn01_00089627 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148128 predicted 5760
2 SASI_Mm01_00148129 predicted 7242
3 SASI_Mm01_00148130 predicted 1784
4 SASI_Mm01_00148131 predicted 7392
5 SASI_Mm01_00148132 predicted 5185
6 SASI_Mm01_00148133 predicted 5567
7 SASI_Mm01_00148134 predicted 5832
8 SASI_Mm01_00148135 predicted 5170
9 SASI_Mm01_00148136 predicted 772
10 SASI_Mm01_00148137 predicted 1629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013675
SPTB MISSION shRNA Bacterial Glycerol Stock
spectrin, beta, erythrocytic
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013675.2-6726s1c1
Sequence:CCGGCCCACCAACATGATTCTACAACTCGAGTTGTAGAATCATGTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013675.2-4056s1c1
Sequence:CCGGGCTCGCAACCTTCACAACAAACTCGAGTTTGTTGTGAAGGTTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013675.2-3006s1c1
Sequence:CCGGCGAGTAAACAATTACTGTGTACTCGAGTACACAGTAATTGTTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013675.2-900s1c1
Sequence:CCGGCCCGAAGATGTCTTCACAGAACTCGAGTTCTGTGAAGACATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013675.2-3453s1c1
Sequence:CCGGGCAGCCATTAAGGAAGAGATTCTCGAGAATCTCTTCCTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013675
SPTB MISSION shRNA shRNA Plasmid DNA
spectrin, beta, erythrocytic
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013675.2-6726s1c1
Sequence:CCGGCCCACCAACATGATTCTACAACTCGAGTTGTAGAATCATGTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013675.2-4056s1c1
Sequence:CCGGGCTCGCAACCTTCACAACAAACTCGAGTTTGTTGTGAAGGTTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013675.2-3006s1c1
Sequence:CCGGCGAGTAAACAATTACTGTGTACTCGAGTACACAGTAATTGTTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013675.2-900s1c1
Sequence:CCGGCCCGAAGATGTCTTCACAGAACTCGAGTTCTGTGAAGACATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013675.2-3453s1c1
Sequence:CCGGGCAGCCATTAAGGAAGAGATTCTCGAGAATCTCTTCCTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013675
SPTB MISSION shRNA Lentiviral Transduction Particles
spectrin, beta, erythrocytic
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013675.2-6726s1c1
Sequence:CCGGCCCACCAACATGATTCTACAACTCGAGTTGTAGAATCATGTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013675.2-4056s1c1
Sequence:CCGGGCTCGCAACCTTCACAACAAACTCGAGTTTGTTGTGAAGGTTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013675.2-3006s1c1
Sequence:CCGGCGAGTAAACAATTACTGTGTACTCGAGTACACAGTAATTGTTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013675.2-900s1c1
Sequence:CCGGCCCGAAGATGTCTTCACAGAACTCGAGTTCTGTGAAGACATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013675.2-3453s1c1
Sequence:CCGGGCAGCCATTAAGGAAGAGATTCTCGAGAATCTCTTCCTTAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000347
SPTB MISSION shRNA Bacterial Glycerol Stock
spectrin, beta, erythrocytic
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000347.3-6609s1c1
Sequence:CCGGGAGGTGTTCTTCATGAGAGTACTCGAGTACTCTCATGAAGAACACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000347.3-852s1c1
Sequence:CCGGCCCGAAGATGTCTTTACGGAACTCGAGTTCCGTAAAGACATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000347.3-3920s1c1
Sequence:CCGGGCTACAGAACTTCCTCCAGAACTCGAGTTCTGGAGGAAGTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000347.3-745s1c1
Sequence:CCGGCCGACCTGATCGACTTTGATACTCGAGTATCAAAGTCGATCAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000347.3-3405s1c1
Sequence:CCGGGCAGGTATCAAGGATGAGATTCTCGAGAATCTCATCCTTGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000347
SPTB MISSION shRNA shRNA Plasmid DNA
spectrin, beta, erythrocytic
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000347.3-6609s1c1
Sequence:CCGGGAGGTGTTCTTCATGAGAGTACTCGAGTACTCTCATGAAGAACACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000347.3-852s1c1
Sequence:CCGGCCCGAAGATGTCTTTACGGAACTCGAGTTCCGTAAAGACATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000347.3-3920s1c1
Sequence:CCGGGCTACAGAACTTCCTCCAGAACTCGAGTTCTGGAGGAAGTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000347.3-745s1c1
Sequence:CCGGCCGACCTGATCGACTTTGATACTCGAGTATCAAAGTCGATCAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000347.3-3405s1c1
Sequence:CCGGGCAGGTATCAAGGATGAGATTCTCGAGAATCTCATCCTTGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000347
SPTB MISSION shRNA Lentiviral Transduction Particles
spectrin, beta, erythrocytic
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000347.3-6609s1c1
Sequence:CCGGGAGGTGTTCTTCATGAGAGTACTCGAGTACTCTCATGAAGAACACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000347.3-852s1c1
Sequence:CCGGCCCGAAGATGTCTTTACGGAACTCGAGTTCCGTAAAGACATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000347.3-3920s1c1
Sequence:CCGGGCTACAGAACTTCCTCCAGAACTCGAGTTCTGGAGGAAGTTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000347.3-745s1c1
Sequence:CCGGCCGACCTGATCGACTTTGATACTCGAGTATCAAAGTCGATCAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000347.3-3405s1c1
Sequence:CCGGGCAGGTATCAAGGATGAGATTCTCGAGAATCTCATCCTTGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks