EMAIL THIS PAGE TO A FRIEND

SPTBN1

spectrin, beta, non-erythrocytic 1

Synonyms: ELF SPTB2 betaSpII
Gene ID:
Human(6711) Summary: Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20742) spectrin beta, non-erythrocytic 1
Rat(305614) spectrin, beta, non-erythrocytic 1
cow(526027) spectrin, beta, non-erythrocytic 1
naked mole-rat(101714374) spectrin, beta, non-erythrocytic 1
domestic guinea pig(100712783) spectrin, beta, non-erythrocytic 1
Zebrafish(100316998) spectrin, beta, non-erythrocytic 1
chicken(421216) spectrin, beta, non-erythrocytic 1
Horse(100052695) spectrin, beta, non-erythrocytic 1
domestic cat(101090509) spectrin, beta, non-erythrocytic 1
dog(403743) spectrin, beta, non-erythrocytic 1
244 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003128 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003128 Rosetta Predictions human pricing
NM_178313 Rosetta Predictions human pricing
NM_001013130 Rosetta Predictions rat pricing
NM_009260 Rosetta Predictions mouse pricing
NM_175836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083730 predicted 1895
2 SASI_Hs01_00083731 predicted 1273
3 SASI_Hs02_00335117 predicted 2737
4 SASI_Hs01_00083732 predicted 6289
5 SASI_Hs01_00083733 predicted 5867
6 SASI_Hs01_00083734 predicted 4013
7 SASI_Hs01_00083735 predicted 4192
8 SASI_Hs01_00083736 predicted 3148
9 SASI_Hs01_00083737 predicted 5659
10 SASI_Hs01_00083738 predicted 1043
11 SASI_Hs01_00083739 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145393 predicted 1989
2 SASI_Hs01_00145394 predicted 1372
3 SASI_Hs02_00369632 predicted 2830
4 SASI_Hs01_00145395 predicted 6383
5 SASI_Hs01_00145396 predicted 5965
6 SASI_Hs01_00145397 predicted 4105
7 SASI_Hs01_00145398 predicted 4281
8 SASI_Hs01_00145399 predicted 3238
9 SASI_Hs01_00145400 predicted 5753
10 SASI_Hs01_00145401 predicted 1143
11 SASI_Hs01_00145402 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047360 predicted 5515
2 SASI_Rn02_00200839 predicted 1244
3 SASI_Rn01_00047361 predicted 5413
4 SASI_Rn01_00047363 predicted 5427
5 SASI_Rn01_00047364 predicted 1149
6 SASI_Rn01_00047365 predicted 4065
7 SASI_Rn01_00047366 predicted 2596
8 SASI_Rn02_00200840 predicted 4121
9 SASI_Rn01_00047368 predicted 1418
10 SASI_Rn01_00047369 predicted 1383
11 SASI_Rn01_00047362 predicted 4042
12 SASI_Rn01_00047367 predicted 4665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030520 predicted 1354
2 SASI_Mm01_00030521 predicted 2648
3 SASI_Mm02_00315741 predicted 4917
4 SASI_Mm02_00315742 predicted 2609
5 SASI_Mm01_00030522 predicted 5164
6 SASI_Mm02_00315743 predicted 2758
7 SASI_Mm01_00030523 predicted 4926
8 SASI_Mm01_00030524 predicted 1409
9 SASI_Mm01_00030526 predicted 6489
10 SASI_Mm01_00030527 predicted 1791
11 SASI_Mm01_00030525 predicted 2646
12 SASI_Mm01_00030528 predicted 4295
13 SASI_Mm01_00030529 predicted 4085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346672 predicted 1012
2 SASI_Mm02_00346673 predicted 2299
3 SASI_Mm02_00346674 predicted 4572
4 SASI_Mm02_00346675 predicted 2270
5 SASI_Mm02_00346676 predicted 4828
6 SASI_Mm02_00346677 predicted 2423
7 SASI_Mm02_00346678 predicted 4581
8 SASI_Mm02_00346679 predicted 1064
9 SASI_Mm02_00346680 predicted 6155
10 SASI_Mm02_00346681 predicted 1446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175836
VALIDATED
SPTBN1 MISSION shRNA Bacterial Glycerol Stock
spectrin, beta, non-erythrocytic 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175836.1-4282s1c1
Sequence:CCGGGCCAGAAATCTGCACAGTAAACTCGAGTTTACTGTGCAGATTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175836.1-832s1c1
Sequence:CCGGCGCTTCCAGATCCAGGATATTCTCGAGAATATCCTGGATCTGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175836.1-4980s1c1
Sequence:CCGGGCCTCGTATTGATGACATCTTCTCGAGAAGATGTCATCAATACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175836.1-4981s1c1
Sequence:CCGGCCTCGTATTGATGACATCTTTCTCGAGAAAGATGTCATCAATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175836.1-6272s1c1
Sequence:CCGGCCTGCATTGAACTTGGGAAATCTCGAGATTTCCCAAGTTCAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175836
VALIDATED
SPTBN1 MISSION shRNA shRNA Plasmid DNA
spectrin, beta, non-erythrocytic 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175836.1-4282s1c1
Sequence:CCGGGCCAGAAATCTGCACAGTAAACTCGAGTTTACTGTGCAGATTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175836.1-832s1c1
Sequence:CCGGCGCTTCCAGATCCAGGATATTCTCGAGAATATCCTGGATCTGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175836.1-4980s1c1
Sequence:CCGGGCCTCGTATTGATGACATCTTCTCGAGAAGATGTCATCAATACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175836.1-4981s1c1
Sequence:CCGGCCTCGTATTGATGACATCTTTCTCGAGAAAGATGTCATCAATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175836.1-6272s1c1
Sequence:CCGGCCTGCATTGAACTTGGGAAATCTCGAGATTTCCCAAGTTCAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175836
VALIDATED
SPTBN1 MISSION shRNA Lentiviral Transduction Particles
spectrin, beta, non-erythrocytic 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175836.1-4282s1c1
Sequence:CCGGGCCAGAAATCTGCACAGTAAACTCGAGTTTACTGTGCAGATTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175836.1-832s1c1
Sequence:CCGGCGCTTCCAGATCCAGGATATTCTCGAGAATATCCTGGATCTGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175836.1-4980s1c1
Sequence:CCGGGCCTCGTATTGATGACATCTTCTCGAGAAGATGTCATCAATACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175836.1-4981s1c1
Sequence:CCGGCCTCGTATTGATGACATCTTTCTCGAGAAAGATGTCATCAATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175836.1-6272s1c1
Sequence:CCGGCCTGCATTGAACTTGGGAAATCTCGAGATTTCCCAAGTTCAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003128
VALIDATED
SPTBN1 MISSION shRNA Bacterial Glycerol Stock
spectrin, beta, non-erythrocytic 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003128.1-4925s1c1
Sequence:CCGGCCTCGCATTGACGACATCTTTCTCGAGAAAGATGTCGTCAATGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003128.1-6182s1c1
Sequence:CCGGGCTGAAATTGATGCACGTAATCTCGAGATTACGTGCATCAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003128.1-1957s1c1
Sequence:CCGGGCTAGTATTGTCTCAAGACTACTCGAGTAGTCTTGAGACAATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003128.1-6945s1c1
Sequence:CCGGCCCACAATAAGAAAGCCTCAACTCGAGTTGAGGCTTTCTTATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003128.1-3071s1c1
Sequence:CCGGCCAAGTGAGAAGGAAATCAAACTCGAGTTTGATTTCCTTCTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003128.2-7675s21c1
Sequence:CCGGAGCGGTGCTTAATCAATATTTCTCGAGAAATATTGATTAAGCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003128.2-3010s21c1
Sequence:CCGGCCAAGTGAGAAGGAAATCAAACTCGAGTTTGATTTCCTTCTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003128.2-6121s21c1
Sequence:CCGGGCTGAAATTGATGCACGTAATCTCGAGATTACGTGCATCAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003128.2-1896s21c1
Sequence:CCGGGCTAGTATTGTCTCAAGACTACTCGAGTAGTCTTGAGACAATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003128
VALIDATED
SPTBN1 MISSION shRNA shRNA Plasmid DNA
spectrin, beta, non-erythrocytic 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003128.1-4925s1c1
Sequence:CCGGCCTCGCATTGACGACATCTTTCTCGAGAAAGATGTCGTCAATGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003128.1-6182s1c1
Sequence:CCGGGCTGAAATTGATGCACGTAATCTCGAGATTACGTGCATCAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003128.1-1957s1c1
Sequence:CCGGGCTAGTATTGTCTCAAGACTACTCGAGTAGTCTTGAGACAATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003128.1-6945s1c1
Sequence:CCGGCCCACAATAAGAAAGCCTCAACTCGAGTTGAGGCTTTCTTATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003128.1-3071s1c1
Sequence:CCGGCCAAGTGAGAAGGAAATCAAACTCGAGTTTGATTTCCTTCTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003128.2-7675s21c1
Sequence:CCGGAGCGGTGCTTAATCAATATTTCTCGAGAAATATTGATTAAGCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003128.2-3010s21c1
Sequence:CCGGCCAAGTGAGAAGGAAATCAAACTCGAGTTTGATTTCCTTCTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003128.2-6121s21c1
Sequence:CCGGGCTGAAATTGATGCACGTAATCTCGAGATTACGTGCATCAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003128.2-1896s21c1
Sequence:CCGGGCTAGTATTGTCTCAAGACTACTCGAGTAGTCTTGAGACAATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003128
VALIDATED
SPTBN1 MISSION shRNA Lentiviral Transduction Particles
spectrin, beta, non-erythrocytic 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003128.1-4925s1c1
Sequence:CCGGCCTCGCATTGACGACATCTTTCTCGAGAAAGATGTCGTCAATGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003128.1-6182s1c1
Sequence:CCGGGCTGAAATTGATGCACGTAATCTCGAGATTACGTGCATCAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003128.1-1957s1c1
Sequence:CCGGGCTAGTATTGTCTCAAGACTACTCGAGTAGTCTTGAGACAATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003128.1-6945s1c1
Sequence:CCGGCCCACAATAAGAAAGCCTCAACTCGAGTTGAGGCTTTCTTATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003128.1-3071s1c1
Sequence:CCGGCCAAGTGAGAAGGAAATCAAACTCGAGTTTGATTTCCTTCTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003128.2-7675s21c1
Sequence:CCGGAGCGGTGCTTAATCAATATTTCTCGAGAAATATTGATTAAGCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003128.2-3010s21c1
Sequence:CCGGCCAAGTGAGAAGGAAATCAAACTCGAGTTTGATTTCCTTCTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003128.2-6121s21c1
Sequence:CCGGGCTGAAATTGATGCACGTAATCTCGAGATTACGTGCATCAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003128.2-1896s21c1
Sequence:CCGGGCTAGTATTGTCTCAAGACTACTCGAGTAGTCTTGAGACAATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks