EMAIL THIS PAGE TO A FRIEND

SPTBN2

spectrin, beta, non-erythrocytic 2

Synonyms: GTRAP41 SCA5 SCAR14
UniProtKB ID: O15020, O14872, O14873
Gene ID:
Human(6712) Summary: Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
Mouse(20743) spectrin beta, non-erythrocytic 2
Rat(29211) spectrin, beta, non-erythrocytic 2
Zebrafish(322068) spectrin, beta, non-erythrocytic 2
domestic cat(101089045) spectrin, beta, non-erythrocytic 2
dog(483706) spectrin, beta, non-erythrocytic 2
domestic guinea pig(100731189) spectrin, beta, non-erythrocytic 2
naked mole-rat(101714181) spectrin, beta, non-erythrocytic 2
Domestic Rabbit(100355265) spectrin, beta, non-erythrocytic 2
cow(100336865) spectrin, beta, non-erythrocytic 2
cow(100336410) spectrin, beta, non-erythrocytic 2
sheep(101106728) spectrin, beta, non-erythrocytic 2
Gene Class: Cytoskeleton
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006946 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021287 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021287 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021287 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006946 Rosetta Predictions human pricing
NM_019167 Rosetta Predictions rat pricing
NM_021287 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154361 predicted 2958
2 SASI_Hs01_00154362 predicted 640
3 SASI_Hs01_00154363 predicted 5282
4 SASI_Hs01_00154364 predicted 528
5 SASI_Hs01_00154365 predicted 5262
6 SASI_Hs01_00154366 predicted 7167
7 SASI_Hs02_00342663 predicted 2842
8 SASI_Hs01_00154367 predicted 5256
9 SASI_Hs02_00342664 predicted 2892
10 SASI_Hs01_00154368 predicted 756
11 SASI_Hs01_00154369 predicted 1925
12 SASI_Hs01_00154370 predicted 6949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076439 predicted 6091
2 SASI_Rn02_00261955 predicted 5302
3 SASI_Rn01_00076440 predicted 5573
4 SASI_Rn01_00076441 predicted 5155
5 SASI_Rn01_00076442 predicted 5554
6 SASI_Rn01_00076443 predicted 526
7 SASI_Rn01_00076444 predicted 6232
8 SASI_Rn01_00076445 predicted 4428
9 SASI_Rn01_00076448 predicted 6859
10 SASI_Rn02_00261956 predicted 1075
11 SASI_Rn01_00076446 predicted 6170
12 SASI_Rn01_00076447 predicted 5926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197343 predicted 5630
2 SASI_Mm01_00197344 predicted 5347
3 SASI_Mm01_00197345 predicted 1571
4 SASI_Mm01_00197346 predicted 3568
5 SASI_Mm01_00197347 predicted 4929
6 SASI_Mm01_00197348 predicted 465
7 SASI_Mm02_00325819 predicted 5568
8 SASI_Mm01_00197349 predicted 4488
9 SASI_Mm01_00197350 predicted 6208
10 SASI_Mm01_00197351 predicted 1026
11 SASI_Mm01_00197352 predicted 2318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006946
SPTBN2 MISSION shRNA Bacterial Glycerol Stock
spectrin, beta, non-erythrocytic 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006946.2-376s21c1
Sequence:CCGGATACTGCCAAAGCCTACAAAGCTCGAGCTTTGTAGGCTTTGGCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006946.2-5258s21c1
Sequence:CCGGTGACTATGCTCCGAGACAAATCTCGAGATTTGTCTCGGAGCATAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006946.1-7416s1c1
Sequence:CCGGGCCCTTCTCTTCTGCTGTTTACTCGAGTAAACAGCAGAAGAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006946.1-4005s1c1
Sequence:CCGGCCTGCATACTAAGTGGCAGAACTCGAGTTCTGCCACTTAGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006946.1-5895s1c1
Sequence:CCGGCGCGGATCTAGTCATCAAGAACTCGAGTTCTTGATGACTAGATCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006946.1-6924s1c1
Sequence:CCGGCGTCGCCTTTGATTACCGAAACTCGAGTTTCGGTAATCAAAGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006946.1-643s1c1
Sequence:CCGGGCAGGTTATCCCAACGTCAATCTCGAGATTGACGTTGGGATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006946
SPTBN2 MISSION shRNA shRNA Plasmid DNA
spectrin, beta, non-erythrocytic 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006946.2-376s21c1
Sequence:CCGGATACTGCCAAAGCCTACAAAGCTCGAGCTTTGTAGGCTTTGGCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006946.2-5258s21c1
Sequence:CCGGTGACTATGCTCCGAGACAAATCTCGAGATTTGTCTCGGAGCATAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006946.1-7416s1c1
Sequence:CCGGGCCCTTCTCTTCTGCTGTTTACTCGAGTAAACAGCAGAAGAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006946.1-4005s1c1
Sequence:CCGGCCTGCATACTAAGTGGCAGAACTCGAGTTCTGCCACTTAGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006946.1-5895s1c1
Sequence:CCGGCGCGGATCTAGTCATCAAGAACTCGAGTTCTTGATGACTAGATCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006946.1-6924s1c1
Sequence:CCGGCGTCGCCTTTGATTACCGAAACTCGAGTTTCGGTAATCAAAGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006946.1-643s1c1
Sequence:CCGGGCAGGTTATCCCAACGTCAATCTCGAGATTGACGTTGGGATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006946
SPTBN2 MISSION shRNA Lentiviral Transduction Particles
spectrin, beta, non-erythrocytic 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006946.2-376s21c1
Sequence:CCGGATACTGCCAAAGCCTACAAAGCTCGAGCTTTGTAGGCTTTGGCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006946.2-5258s21c1
Sequence:CCGGTGACTATGCTCCGAGACAAATCTCGAGATTTGTCTCGGAGCATAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006946.1-7416s1c1
Sequence:CCGGGCCCTTCTCTTCTGCTGTTTACTCGAGTAAACAGCAGAAGAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006946.1-4005s1c1
Sequence:CCGGCCTGCATACTAAGTGGCAGAACTCGAGTTCTGCCACTTAGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006946.1-5895s1c1
Sequence:CCGGCGCGGATCTAGTCATCAAGAACTCGAGTTCTTGATGACTAGATCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006946.1-6924s1c1
Sequence:CCGGCGTCGCCTTTGATTACCGAAACTCGAGTTTCGGTAATCAAAGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006946.1-643s1c1
Sequence:CCGGGCAGGTTATCCCAACGTCAATCTCGAGATTGACGTTGGGATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021287
VALIDATED
SPTBN2 MISSION shRNA Bacterial Glycerol Stock
spectrin, beta, non-erythrocytic 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021287.1-5365s21c1
Sequence:CCGGGCCCAGACCATCAAACAACTACTCGAGTAGTTGTTTGATGGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021287.1-5212s21c1
Sequence:CCGGGCCCAGCAATTCTATCGTGATCTCGAGATCACGATAGAATTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021287.1-7779s21c1
Sequence:CCGGCCTTCTCTTCTGCTATTTAATCTCGAGATTAAATAGCAGAAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021287.1-6582s21c1
Sequence:CCGGCGAAGTAGAGAGCCTCATCAACTCGAGTTGATGAGGCTCTCTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021287.1-1398s21c1
Sequence:CCGGGCAGTGGATTGAGCAAACGATCTCGAGATCGTTTGCTCAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021287.1-7779s1c1
Sequence:CCGGCCTTCTCTTCTGCTATTTAATCTCGAGATTAAATAGCAGAAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021287.1-5212s1c1
Sequence:CCGGGCCCAGCAATTCTATCGTGATCTCGAGATCACGATAGAATTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021287.1-5365s1c1
Sequence:CCGGGCCCAGACCATCAAACAACTACTCGAGTAGTTGTTTGATGGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021287.1-1398s1c1
Sequence:CCGGGCAGTGGATTGAGCAAACGATCTCGAGATCGTTTGCTCAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021287.1-6582s1c1
Sequence:CCGGCGAAGTAGAGAGCCTCATCAACTCGAGTTGATGAGGCTCTCTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021287
VALIDATED
SPTBN2 MISSION shRNA shRNA Plasmid DNA
spectrin, beta, non-erythrocytic 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021287.1-5365s21c1
Sequence:CCGGGCCCAGACCATCAAACAACTACTCGAGTAGTTGTTTGATGGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021287.1-5212s21c1
Sequence:CCGGGCCCAGCAATTCTATCGTGATCTCGAGATCACGATAGAATTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021287.1-7779s21c1
Sequence:CCGGCCTTCTCTTCTGCTATTTAATCTCGAGATTAAATAGCAGAAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021287.1-6582s21c1
Sequence:CCGGCGAAGTAGAGAGCCTCATCAACTCGAGTTGATGAGGCTCTCTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021287.1-1398s21c1
Sequence:CCGGGCAGTGGATTGAGCAAACGATCTCGAGATCGTTTGCTCAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021287.1-7779s1c1
Sequence:CCGGCCTTCTCTTCTGCTATTTAATCTCGAGATTAAATAGCAGAAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021287.1-5212s1c1
Sequence:CCGGGCCCAGCAATTCTATCGTGATCTCGAGATCACGATAGAATTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021287.1-5365s1c1
Sequence:CCGGGCCCAGACCATCAAACAACTACTCGAGTAGTTGTTTGATGGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021287.1-1398s1c1
Sequence:CCGGGCAGTGGATTGAGCAAACGATCTCGAGATCGTTTGCTCAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021287.1-6582s1c1
Sequence:CCGGCGAAGTAGAGAGCCTCATCAACTCGAGTTGATGAGGCTCTCTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021287
VALIDATED
SPTBN2 MISSION shRNA Lentiviral Transduction Particles
spectrin, beta, non-erythrocytic 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021287.1-5365s21c1
Sequence:CCGGGCCCAGACCATCAAACAACTACTCGAGTAGTTGTTTGATGGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021287.1-5212s21c1
Sequence:CCGGGCCCAGCAATTCTATCGTGATCTCGAGATCACGATAGAATTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021287.1-7779s21c1
Sequence:CCGGCCTTCTCTTCTGCTATTTAATCTCGAGATTAAATAGCAGAAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021287.1-6582s21c1
Sequence:CCGGCGAAGTAGAGAGCCTCATCAACTCGAGTTGATGAGGCTCTCTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021287.1-1398s21c1
Sequence:CCGGGCAGTGGATTGAGCAAACGATCTCGAGATCGTTTGCTCAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021287.1-7779s1c1
Sequence:CCGGCCTTCTCTTCTGCTATTTAATCTCGAGATTAAATAGCAGAAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021287.1-5212s1c1
Sequence:CCGGGCCCAGCAATTCTATCGTGATCTCGAGATCACGATAGAATTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021287.1-5365s1c1
Sequence:CCGGGCCCAGACCATCAAACAACTACTCGAGTAGTTGTTTGATGGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021287.1-1398s1c1
Sequence:CCGGGCAGTGGATTGAGCAAACGATCTCGAGATCGTTTGCTCAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021287.1-6582s1c1
Sequence:CCGGCGAAGTAGAGAGCCTCATCAACTCGAGTTGATGAGGCTCTCTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks