EMAIL THIS PAGE TO A FRIEND

SPTBN4

spectrin, beta, non-erythrocytic 4

Synonyms: QV SPNB4 SPTBN3
Gene ID:
Human(57731) Summary: Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(80297) spectrin beta, non-erythrocytic 4
Rat(308458) spectrin, beta, non-erythrocytic 4
cow(537578) spectrin, beta, non-erythrocytic 4
sheep(101120011) spectrin, beta, non-erythrocytic 4
naked mole-rat(101697752) spectrin, beta, non-erythrocytic 4
domestic guinea pig(100724245) spectrin, beta, non-erythrocytic 4
chicken(430775) spectrin, beta, non-erythrocytic 4
dog(484499) spectrin, beta, non-erythrocytic 4
domestic cat(101088707) spectrin, beta, non-erythrocytic 4
Gene Class: Cytoskeleton
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020971 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU032281 MISSION® esiRNA esiRNA targeting mouse Spnb4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020971 Rosetta Predictions human pricing
NM_025213 Rosetta Predictions human pricing
XM_001072073 Rosetta Predictions rat pricing
XM_218364 Rosetta Predictions rat pricing
NM_032610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354399 predicted 5226
2 SASI_Hs01_00026478 predicted 4429
3 SASI_Hs02_00354400 predicted 5476
4 SASI_Hs02_00354401 predicted 5304
5 SASI_Hs02_00354402 predicted 4561
6 SASI_Hs02_00354403 predicted 5616
7 SASI_Hs02_00354404 predicted 5186
8 SASI_Hs02_00354405 predicted 5601
9 SASI_Hs02_00354406 predicted 5122
10 SASI_Hs02_00354407 predicted 5042
11 SASI_Hs01_00026474 predicted 3956
12 SASI_Hs01_00026475 predicted 6663
13 SASI_Hs01_00026476 predicted 5014
14 SASI_Hs01_00026477 predicted 2483
15 SASI_Hs01_00026479 predicted 6351
16 SASI_Hs01_00026480 predicted 1132
17 SASI_Hs01_00026481 predicted 7709
18 SASI_Hs01_00026482 predicted 2672
19 SASI_Hs01_00026483 predicted 4303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357989 predicted 1284
2 SASI_Hs01_00205749 predicted 480
3 SASI_Hs02_00357990 predicted 1525
4 SASI_Hs02_00357991 predicted 1358
5 SASI_Hs02_00357992 predicted 616
6 SASI_Hs02_00357993 predicted 1666
7 SASI_Hs02_00357994 predicted 1243
8 SASI_Hs02_00357995 predicted 1653
9 SASI_Hs02_00357996 predicted 1174
10 SASI_Hs02_00357997 predicted 1089
11 SASI_Hs01_00205745 predicted 4037
12 SASI_Hs01_00205746 predicted 1006
13 SASI_Hs01_00205747 predicted 6731
14 SASI_Hs01_00205748 predicted 5088
15 SASI_Hs01_00205750 predicted 6434
16 SASI_Hs01_00205751 predicted 1224
17 SASI_Hs01_00205752 predicted 7788
18 SASI_Hs01_00205753 predicted 2746
19 SASI_Hs01_00205754 predicted 4381
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337700 predicted 6171
2 SASI_Rn02_00337701 predicted 6692
3 SASI_Rn02_00337702 predicted 7745
4 SASI_Rn02_00337703 predicted 2533
5 SASI_Rn02_00337704 predicted 4484
6 SASI_Rn02_00337705 predicted 1431
7 SASI_Rn02_00337706 predicted 6089
8 SASI_Rn02_00337707 predicted 2933
9 SASI_Rn02_00337708 predicted 2810
10 SASI_Rn02_00337709 predicted 5913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377701 predicted 6196
2 SASI_Rn02_00377702 predicted 6725
3 SASI_Rn02_00377703 predicted 7771
4 SASI_Rn02_00377704 predicted 2546
5 SASI_Rn02_00377705 predicted 4495
6 SASI_Rn02_00377706 predicted 1449
7 SASI_Rn02_00377707 predicted 6115
8 SASI_Rn02_00377708 predicted 2945
9 SASI_Rn02_00377709 predicted 1464
10 SASI_Rn02_00377710 predicted 2832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088733 predicted 781
2 SASI_Mm01_00088734 predicted 838
3 SASI_Mm01_00088735 predicted 2109
4 SASI_Mm01_00088736 predicted 277
5 SASI_Mm01_00088737 predicted 940
6 SASI_Mm01_00088738 predicted 2957
7 SASI_Mm01_00088739 predicted 618
8 SASI_Mm01_00088740 predicted 291
9 SASI_Mm01_00088741 predicted 7096
10 SASI_Mm01_00088742 predicted 3826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032610
SPTBN4 MISSION shRNA Bacterial Glycerol Stock
spectrin, beta, non-erythrocytic 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032610.1-6145s1c1
Sequence:CCGGGCGGTCTCTATTACTCAACAACTCGAGTTGTTGAGTAATAGAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032610.1-7100s1c1
Sequence:CCGGGCTGATATTGTGGAGCAACTTCTCGAGAAGTTGCTCCACAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032610.1-737s1c1
Sequence:CCGGCCTGAGGTAAACATCCAGAATCTCGAGATTCTGGATGTTTACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032610.1-4273s1c1
Sequence:CCGGGCGCAAGAAATTAGGTGAGATCTCGAGATCTCACCTAATTTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032610.2-6456s21c1
Sequence:CCGGGCTTGACCACGATCGAGAAACCTCGAGGTTTCTCGATCGTGGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032610.2-4995s21c1
Sequence:CCGGAGGTGGAACAGTACTACTTTGCTCGAGCAAAGTAGTACTGTTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032610.2-6052s21c1
Sequence:CCGGGTCATCGGTGGAGGTGCTTATCTCGAGATAAGCACCTCCACCGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032610.2-2879s21c1
Sequence:CCGGGAGGTGGTGCAGCATCGATTTCTCGAGAAATCGATGCTGCACCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032610
SPTBN4 MISSION shRNA shRNA Plasmid DNA
spectrin, beta, non-erythrocytic 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032610.1-6145s1c1
Sequence:CCGGGCGGTCTCTATTACTCAACAACTCGAGTTGTTGAGTAATAGAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032610.1-7100s1c1
Sequence:CCGGGCTGATATTGTGGAGCAACTTCTCGAGAAGTTGCTCCACAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032610.1-737s1c1
Sequence:CCGGCCTGAGGTAAACATCCAGAATCTCGAGATTCTGGATGTTTACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032610.1-4273s1c1
Sequence:CCGGGCGCAAGAAATTAGGTGAGATCTCGAGATCTCACCTAATTTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032610.2-6456s21c1
Sequence:CCGGGCTTGACCACGATCGAGAAACCTCGAGGTTTCTCGATCGTGGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032610.2-4995s21c1
Sequence:CCGGAGGTGGAACAGTACTACTTTGCTCGAGCAAAGTAGTACTGTTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032610.2-6052s21c1
Sequence:CCGGGTCATCGGTGGAGGTGCTTATCTCGAGATAAGCACCTCCACCGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032610.2-2879s21c1
Sequence:CCGGGAGGTGGTGCAGCATCGATTTCTCGAGAAATCGATGCTGCACCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032610
SPTBN4 MISSION shRNA Lentiviral Transduction Particles
spectrin, beta, non-erythrocytic 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032610.1-6145s1c1
Sequence:CCGGGCGGTCTCTATTACTCAACAACTCGAGTTGTTGAGTAATAGAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032610.1-7100s1c1
Sequence:CCGGGCTGATATTGTGGAGCAACTTCTCGAGAAGTTGCTCCACAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032610.1-737s1c1
Sequence:CCGGCCTGAGGTAAACATCCAGAATCTCGAGATTCTGGATGTTTACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032610.1-4273s1c1
Sequence:CCGGGCGCAAGAAATTAGGTGAGATCTCGAGATCTCACCTAATTTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032610.2-6456s21c1
Sequence:CCGGGCTTGACCACGATCGAGAAACCTCGAGGTTTCTCGATCGTGGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032610.2-4995s21c1
Sequence:CCGGAGGTGGAACAGTACTACTTTGCTCGAGCAAAGTAGTACTGTTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032610.2-6052s21c1
Sequence:CCGGGTCATCGGTGGAGGTGCTTATCTCGAGATAAGCACCTCCACCGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032610.2-2879s21c1
Sequence:CCGGGAGGTGGTGCAGCATCGATTTCTCGAGAAATCGATGCTGCACCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020971
SPTBN4 MISSION shRNA Bacterial Glycerol Stock
spectrin, beta, non-erythrocytic 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020971.1-8243s1c1
Sequence:CCGGCGCCTTTACCTCACTTCCAATCTCGAGATTGGAAGTGAGGTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020971.1-1482s1c1
Sequence:CCGGGCAGCCATGAAGAAACACGAACTCGAGTTCGTGTTTCTTCATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020971.1-2867s1c1
Sequence:CCGGCCAAGAGATGAACAGCCTGATCTCGAGATCAGGCTGTTCATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020971.1-915s1c1
Sequence:CCGGGTGGTCTCTTTCTACCACTATCTCGAGATAGTGGTAGAAAGAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020971.1-914s1c1
Sequence:CCGGCGTGGTCTCTTTCTACCACTACTCGAGTAGTGGTAGAAAGAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020971.2-3023s21c1
Sequence:CCGGAGCTAGTGGAACAGCGCAAAGCTCGAGCTTTGCGCTGTTCCACTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020971.2-1091s21c1
Sequence:CCGGGCCTCATCAGCAATCAGAAATCTCGAGATTTCTGATTGCTGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020971.2-1590s21c1
Sequence:CCGGAGCCGAAGGCTACTACGATATCTCGAGATATCGTAGTAGCCTTCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020971.2-696s21c1
Sequence:CCGGTGAGGTAAACATCCAGAATTTCTCGAGAAATTCTGGATGTTTACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020971
SPTBN4 MISSION shRNA shRNA Plasmid DNA
spectrin, beta, non-erythrocytic 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020971.1-8243s1c1
Sequence:CCGGCGCCTTTACCTCACTTCCAATCTCGAGATTGGAAGTGAGGTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020971.1-1482s1c1
Sequence:CCGGGCAGCCATGAAGAAACACGAACTCGAGTTCGTGTTTCTTCATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020971.1-2867s1c1
Sequence:CCGGCCAAGAGATGAACAGCCTGATCTCGAGATCAGGCTGTTCATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020971.1-915s1c1
Sequence:CCGGGTGGTCTCTTTCTACCACTATCTCGAGATAGTGGTAGAAAGAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020971.1-914s1c1
Sequence:CCGGCGTGGTCTCTTTCTACCACTACTCGAGTAGTGGTAGAAAGAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020971.2-3023s21c1
Sequence:CCGGAGCTAGTGGAACAGCGCAAAGCTCGAGCTTTGCGCTGTTCCACTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020971.2-1091s21c1
Sequence:CCGGGCCTCATCAGCAATCAGAAATCTCGAGATTTCTGATTGCTGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020971.2-1590s21c1
Sequence:CCGGAGCCGAAGGCTACTACGATATCTCGAGATATCGTAGTAGCCTTCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020971.2-696s21c1
Sequence:CCGGTGAGGTAAACATCCAGAATTTCTCGAGAAATTCTGGATGTTTACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020971
SPTBN4 MISSION shRNA Lentiviral Transduction Particles
spectrin, beta, non-erythrocytic 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020971.1-8243s1c1
Sequence:CCGGCGCCTTTACCTCACTTCCAATCTCGAGATTGGAAGTGAGGTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020971.1-1482s1c1
Sequence:CCGGGCAGCCATGAAGAAACACGAACTCGAGTTCGTGTTTCTTCATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020971.1-2867s1c1
Sequence:CCGGCCAAGAGATGAACAGCCTGATCTCGAGATCAGGCTGTTCATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020971.1-915s1c1
Sequence:CCGGGTGGTCTCTTTCTACCACTATCTCGAGATAGTGGTAGAAAGAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020971.1-914s1c1
Sequence:CCGGCGTGGTCTCTTTCTACCACTACTCGAGTAGTGGTAGAAAGAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020971.2-3023s21c1
Sequence:CCGGAGCTAGTGGAACAGCGCAAAGCTCGAGCTTTGCGCTGTTCCACTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020971.2-1091s21c1
Sequence:CCGGGCCTCATCAGCAATCAGAAATCTCGAGATTTCTGATTGCTGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020971.2-1590s21c1
Sequence:CCGGAGCCGAAGGCTACTACGATATCTCGAGATATCGTAGTAGCCTTCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020971.2-696s21c1
Sequence:CCGGTGAGGTAAACATCCAGAATTTCTCGAGAAATTCTGGATGTTTACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks