EMAIL THIS PAGE TO A FRIEND

SPTBN5

spectrin, beta, non-erythrocytic 5

Synonyms: BSPECV HUBSPECV HUSPECV
UniProtKB ID: Q9NRC6
Gene ID:
Mouse(640524) spectrin beta, non-erythrocytic 5
Rat(296090) spectrin, beta, non-erythrocytic 5
chicken(423225) spectrin, beta, non-erythrocytic 5
domestic cat(101083088) spectrin, beta, non-erythrocytic 5
Horse(100071053) spectrin, beta, non-erythrocytic 5
dog(487513) spectrin, beta, non-erythrocytic 5
domestic guinea pig(100734280) spectrin, beta, non-erythrocytic 5
Domestic Rabbit(100341289) spectrin, beta, non-erythrocytic 5
cow(531014) spectrin, beta, non-erythrocytic 5
sheep(101117167) spectrin, beta, non-erythrocytic 5
Gene Class: Cytoskeleton
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
S1515 Anti-Spectrin antibody produced in rabbit whole antiserum human
western blot pricing
SAB4300943 Anti-SPTBN5 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016642 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016642 Rosetta Predictions human pricing
XM_001080881 Rosetta Predictions rat pricing
XM_238278 Rosetta Predictions rat pricing
XM_001481329 Rosetta Predictions mouse pricing
XM_917520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218130 predicted 3974
2 SASI_Hs01_00218131 predicted 9659
3 SASI_Hs01_00218132 predicted 1013
4 SASI_Hs01_00218133 predicted 5105
5 SASI_Hs01_00218134 predicted 10640
6 SASI_Hs01_00218135 predicted 7642
7 SASI_Hs02_00349809 predicted 1996
8 SASI_Hs02_00349810 predicted 7343
9 SASI_Hs01_00218137 predicted 5752
10 SASI_Hs01_00218138 predicted 1024
11 SASI_Hs01_00218129 predicted 6840
12 SASI_Hs01_00218136 predicted 2808
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369700 predicted 4446
2 SASI_Rn02_00369701 predicted 2231
3 SASI_Rn02_00369702 predicted 4077
4 SASI_Rn02_00369703 predicted 4548
5 SASI_Rn02_00369704 predicted 9288
6 SASI_Rn02_00369705 predicted 2703
7 SASI_Rn02_00369706 predicted 7038
8 SASI_Rn02_00369707 predicted 9755
9 SASI_Rn02_00369708 predicted 9573
10 SASI_Rn02_00369709 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391286 predicted 4444
2 SASI_Rn02_00391287 predicted 2222
3 SASI_Rn02_00391288 predicted 4078
4 SASI_Rn02_00391289 predicted 4555
5 SASI_Rn02_00391290 predicted 668
6 SASI_Rn02_00391291 predicted 2699
7 SASI_Rn02_00391292 predicted 7041
8 SASI_Rn02_00391293 predicted 6738
9 SASI_Rn02_00391294 predicted 7477
10 SASI_Rn02_00391295 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423762 predicted 4186
2 SASI_Mm02_00423763 predicted 5933
3 SASI_Mm02_00423764 predicted 4216
4 SASI_Mm02_00423765 predicted 7003
5 SASI_Mm02_00423766 predicted 2363
6 SASI_Mm02_00423767 predicted 1645
7 SASI_Mm02_00423768 predicted 7183
8 SASI_Mm02_00423769 predicted 249
9 SASI_Mm02_00423770 predicted 2916
10 SASI_Mm02_00423771 predicted 4873
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441233 predicted 4183
2 SASI_Mm02_00441234 predicted 4212
3 SASI_Mm02_00441235 predicted 7013
4 SASI_Mm02_00441236 predicted 2367
5 SASI_Mm02_00441237 predicted 1643
6 SASI_Mm02_00441238 predicted 7191
7 SASI_Mm02_00441239 predicted 245
8 SASI_Mm02_00441240 predicted 2915
9 SASI_Mm02_00441241 predicted 4872
10 SASI_Mm02_00441242 predicted 5450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016642
SPTBN5 MISSION shRNA Bacterial Glycerol Stock
spectrin, beta, non-erythrocytic 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016642.2-2809s21c1
Sequence:CCGGGACTTTGATCCCAACACTATACTCGAGTATAGTGTTGGGATCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016642.2-3390s21c1
Sequence:CCGGCCTCCAAAGTGTGGTCGTAAACTCGAGTTTACGACCACACTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016642.2-674s21c1
Sequence:CCGGGACTCATCTGGGTCATCATTCCTCGAGGAATGATGACCCAGATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113906    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016642.1-11297s1c1
Sequence:CCGGGACACATCTAAGGGACCAGAACTCGAGTTCTGGTCCCTTAGATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016642.1-1540s1c1
Sequence:CCGGCGGGAGAGTTTCCTTAAGGATCTCGAGATCCTTAAGGAAACTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016642.1-8544s1c1
Sequence:CCGGGCAAGACAACTCCCAGAAGAACTCGAGTTCTTCTGGGAGTTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016642.1-7744s1c1
Sequence:CCGGCGGCGTATGTTAGAAGAGCATCTCGAGATGCTCTTCTAACATACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016642.1-3024s1c1
Sequence:CCGGGCAGCTCAAATATGAGAACTTCTCGAGAAGTTCTCATATTTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016642
SPTBN5 MISSION shRNA shRNA Plasmid DNA
spectrin, beta, non-erythrocytic 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016642.2-2809s21c1
Sequence:CCGGGACTTTGATCCCAACACTATACTCGAGTATAGTGTTGGGATCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016642.2-3390s21c1
Sequence:CCGGCCTCCAAAGTGTGGTCGTAAACTCGAGTTTACGACCACACTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016642.2-674s21c1
Sequence:CCGGGACTCATCTGGGTCATCATTCCTCGAGGAATGATGACCCAGATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113906    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016642.1-11297s1c1
Sequence:CCGGGACACATCTAAGGGACCAGAACTCGAGTTCTGGTCCCTTAGATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016642.1-1540s1c1
Sequence:CCGGCGGGAGAGTTTCCTTAAGGATCTCGAGATCCTTAAGGAAACTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016642.1-8544s1c1
Sequence:CCGGGCAAGACAACTCCCAGAAGAACTCGAGTTCTTCTGGGAGTTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016642.1-7744s1c1
Sequence:CCGGCGGCGTATGTTAGAAGAGCATCTCGAGATGCTCTTCTAACATACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016642.1-3024s1c1
Sequence:CCGGGCAGCTCAAATATGAGAACTTCTCGAGAAGTTCTCATATTTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016642
SPTBN5 MISSION shRNA Lentiviral Transduction Particles
spectrin, beta, non-erythrocytic 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016642.2-2809s21c1
Sequence:CCGGGACTTTGATCCCAACACTATACTCGAGTATAGTGTTGGGATCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016642.2-3390s21c1
Sequence:CCGGCCTCCAAAGTGTGGTCGTAAACTCGAGTTTACGACCACACTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016642.2-674s21c1
Sequence:CCGGGACTCATCTGGGTCATCATTCCTCGAGGAATGATGACCCAGATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113906    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016642.1-11297s1c1
Sequence:CCGGGACACATCTAAGGGACCAGAACTCGAGTTCTGGTCCCTTAGATGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016642.1-1540s1c1
Sequence:CCGGCGGGAGAGTTTCCTTAAGGATCTCGAGATCCTTAAGGAAACTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016642.1-8544s1c1
Sequence:CCGGGCAAGACAACTCCCAGAAGAACTCGAGTTCTTCTGGGAGTTGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016642.1-7744s1c1
Sequence:CCGGCGGCGTATGTTAGAAGAGCATCTCGAGATGCTCTTCTAACATACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016642.1-3024s1c1
Sequence:CCGGGCAGCTCAAATATGAGAACTTCTCGAGAAGTTCTCATATTTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks