EMAIL THIS PAGE TO A FRIEND

SPTLC1

serine palmitoyltransferase, long chain base subunit 1

Synonyms: HSAN1 HSN1 LBC1 LCB1 SPT1 SPTI
UniProtKB ID: O15269, A8K681, Q5VWB4, Q96IX6
Gene ID:
Human(10558) Summary: Serine palmitoyltransferase, which consists of two different subunits, is the key enzyme in sphingolipid biosynthesis. It converts L-serine and palmitoyl-CoA to 3-oxosphinganine with pyridoxal 5'-phosphate as a cofactor. The product of this gene is the long chain base subunit 1 of serine palmitoyltransferase. Mutations in this gene were identified in patients with hereditary sensory neuropathy type 1. Alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(268656) serine palmitoyltransferase, long chain base subunit 1
Rat(361213) serine palmitoyltransferase, long chain base subunit 1
Zebrafish(553981) serine palmitoyltransferase, long chain base subunit 1
chicken(426145) serine palmitoyltransferase, long chain base subunit 1
domestic cat(101087947) serine palmitoyltransferase, long chain base subunit 1
dog(484192) serine palmitoyltransferase, long chain base subunit 1
cow(614165) serine palmitoyltransferase, long chain base subunit 1
sheep(101105721) serine palmitoyltransferase, long chain base subunit 1
Domestic Rabbit(100344536) serine palmitoyltransferase, long chain base subunit 1
naked mole-rat(101716616) serine palmitoyltransferase, long chain base subunit 1
domestic guinea pig(100726468) serine palmitoyltransferase, long chain base subunit 1
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C1159 L-Cycloserine pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006415 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082241 MISSION® esiRNA esiRNA human SPTLC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006415 Rosetta Predictions human pricing
NM_178324 Rosetta Predictions human pricing
NM_001108406 Rosetta Predictions rat pricing
NM_009269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050440 predicted 552
2 SASI_Hs01_00050442 predicted 393
3 SASI_Hs01_00050443 predicted 1075
4 SASI_Hs02_00341526 predicted 1212
5 SASI_Hs01_00050445 predicted 646
6 SASI_Hs01_00050446 predicted 1014
7 SASI_Hs01_00050447 predicted 621
8 SASI_Hs02_00341527 predicted 905
9 SASI_Hs01_00050448 predicted 805
10 SASI_Hs01_00050449 predicted 737
11 SASI_Hs01_00050441 predicted 916
12 SASI_Hs01_00050444 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064650 predicted 331
2 SASI_Hs01_00064651 predicted 382
3 SASI_Hs01_00064652 predicted 388
4 SASI_Hs01_00064653 predicted 426
5 SASI_Hs01_00064654 predicted 328
6 SASI_Hs01_00064655 predicted 333
7 SASI_Hs01_00064656 predicted 429
8 SASI_Hs01_00064657 predicted 356
9 SASI_Hs02_00369635 predicted 224
10 SASI_Hs01_00064658 predicted 363
11 SASI_Hs01_00064659 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238349 predicted 1052
2 SASI_Rn02_00238350 predicted 488
3 SASI_Rn02_00238351 predicted 903
4 SASI_Rn02_00238352 predicted 621
5 SASI_Rn02_00238353 predicted 428
6 SASI_Rn02_00238354 predicted 317
7 SASI_Rn02_00238355 predicted 273
8 SASI_Rn02_00238356 predicted 1282
9 SASI_Rn02_00238357 predicted 740
10 SASI_Rn02_00238358 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129145 predicted 1251
2 SASI_Mm01_00129146 predicted 350
3 SASI_Mm01_00129147 predicted 413
4 SASI_Mm02_00315759 predicted 611
5 SASI_Mm01_00129148 predicted 1050
6 SASI_Mm01_00129149 predicted 349
7 SASI_Mm01_00129150 predicted 1278
8 SASI_Mm01_00129152 predicted 889
9 SASI_Mm01_00129153 predicted 903
10 SASI_Mm01_00129154 predicted 1124
11 SASI_Mm01_00129151 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006415
VALIDATED
SPTLC1 MISSION shRNA Bacterial Glycerol Stock
serine palmitoyltransferase, long chain base subunit 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006415.2-1294s1c1
Sequence:CCGGGCATGAACAGAAGTATTGCATCTCGAGATGCAATACTTCTGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006415.2-393s1c1
Sequence:CCGGGCAGCAGCTTTAGCATCTCTACTCGAGTAGAGATGCTAAAGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006415.2-609s1c1
Sequence:CCGGGCCTGCTTTGCTATTCAGAAACTCGAGTTTCTGAATAGCAAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006415.2-753s1c1
Sequence:CCGGCGGCGTTTCATTGTAGTAGAACTCGAGTTCTACTACAATGAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006415.2-558s21c1
Sequence:CCGGGCTATTCCTGCTTACTCTAAACTCGAGTTTAGAGTAAGCAGGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006415.2-1840s21c1
Sequence:CCGGCTCCTTAACTCCTTAGTATTTCTCGAGAAATACTAAGGAGTTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006415.2-1294s21c1
Sequence:CCGGGCATGAACAGAAGTATTGCATCTCGAGATGCAATACTTCTGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006415.2-393s21c1
Sequence:CCGGGCAGCAGCTTTAGCATCTCTACTCGAGTAGAGATGCTAAAGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006415.2-645s21c1
Sequence:CCGGCGTAGTGACATTAAGTTATTTCTCGAGAAATAACTTAATGTCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006415
VALIDATED
SPTLC1 MISSION shRNA shRNA Plasmid DNA
serine palmitoyltransferase, long chain base subunit 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006415.2-1294s1c1
Sequence:CCGGGCATGAACAGAAGTATTGCATCTCGAGATGCAATACTTCTGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006415.2-393s1c1
Sequence:CCGGGCAGCAGCTTTAGCATCTCTACTCGAGTAGAGATGCTAAAGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006415.2-609s1c1
Sequence:CCGGGCCTGCTTTGCTATTCAGAAACTCGAGTTTCTGAATAGCAAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006415.2-753s1c1
Sequence:CCGGCGGCGTTTCATTGTAGTAGAACTCGAGTTCTACTACAATGAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006415.2-558s21c1
Sequence:CCGGGCTATTCCTGCTTACTCTAAACTCGAGTTTAGAGTAAGCAGGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006415.2-1840s21c1
Sequence:CCGGCTCCTTAACTCCTTAGTATTTCTCGAGAAATACTAAGGAGTTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006415.2-1294s21c1
Sequence:CCGGGCATGAACAGAAGTATTGCATCTCGAGATGCAATACTTCTGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006415.2-393s21c1
Sequence:CCGGGCAGCAGCTTTAGCATCTCTACTCGAGTAGAGATGCTAAAGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006415.2-645s21c1
Sequence:CCGGCGTAGTGACATTAAGTTATTTCTCGAGAAATAACTTAATGTCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006415
VALIDATED
SPTLC1 MISSION shRNA Lentiviral Transduction Particles
serine palmitoyltransferase, long chain base subunit 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006415.2-1294s1c1
Sequence:CCGGGCATGAACAGAAGTATTGCATCTCGAGATGCAATACTTCTGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006415.2-393s1c1
Sequence:CCGGGCAGCAGCTTTAGCATCTCTACTCGAGTAGAGATGCTAAAGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006415.2-609s1c1
Sequence:CCGGGCCTGCTTTGCTATTCAGAAACTCGAGTTTCTGAATAGCAAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006415.2-753s1c1
Sequence:CCGGCGGCGTTTCATTGTAGTAGAACTCGAGTTCTACTACAATGAAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006415.2-558s21c1
Sequence:CCGGGCTATTCCTGCTTACTCTAAACTCGAGTTTAGAGTAAGCAGGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006415.2-1840s21c1
Sequence:CCGGCTCCTTAACTCCTTAGTATTTCTCGAGAAATACTAAGGAGTTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006415.2-1294s21c1
Sequence:CCGGGCATGAACAGAAGTATTGCATCTCGAGATGCAATACTTCTGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006415.2-393s21c1
Sequence:CCGGGCAGCAGCTTTAGCATCTCTACTCGAGTAGAGATGCTAAAGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006415.2-645s21c1
Sequence:CCGGCGTAGTGACATTAAGTTATTTCTCGAGAAATAACTTAATGTCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009269
VALIDATED
SPTLC1 MISSION shRNA Bacterial Glycerol Stock
serine palmitoyltransferase, long chain base subunit 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009269.2-2275s1c1
Sequence:CCGGGCGAGCGTGTTGAGTGATATACTCGAGTATATCACTCAACACGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009269.2-418s1c1
Sequence:CCGGCGAGGGTTCTATGGCACATTTCTCGAGAAATGTGCCATAGAACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009269.2-243s1c1
Sequence:CCGGCCCTGCTCTCAACTACAACATCTCGAGATGTTGTAGTTGAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009269.2-779s1c1
Sequence:CCGGCCCTTCCAGAACTGGTTAAATCTCGAGATTTAACCAGTTCTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009269.2-883s1c1
Sequence:CCGGGAGCACTATGGGATCAGTATTCTCGAGAATACTGATCCCATAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-883s21c1
Sequence:CCGGGAGCACTATGGGATCAGTATTCTCGAGAATACTGATCCCATAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-2275s21c1
Sequence:CCGGGCGAGCGTGTTGAGTGATATACTCGAGTATATCACTCAACACGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-243s21c1
Sequence:CCGGCCCTGCTCTCAACTACAACATCTCGAGATGTTGTAGTTGAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-1143s21c1
Sequence:CCGGACAAGGTGTTTCGGGTTTAAACTCGAGTTTAAACCCGAAACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-483s21c1
Sequence:CCGGGACCGAAGAAGCCATCATTTACTCGAGTAAATGATGGCTTCTTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009269
VALIDATED
SPTLC1 MISSION shRNA shRNA Plasmid DNA
serine palmitoyltransferase, long chain base subunit 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009269.2-2275s1c1
Sequence:CCGGGCGAGCGTGTTGAGTGATATACTCGAGTATATCACTCAACACGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009269.2-418s1c1
Sequence:CCGGCGAGGGTTCTATGGCACATTTCTCGAGAAATGTGCCATAGAACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009269.2-243s1c1
Sequence:CCGGCCCTGCTCTCAACTACAACATCTCGAGATGTTGTAGTTGAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009269.2-779s1c1
Sequence:CCGGCCCTTCCAGAACTGGTTAAATCTCGAGATTTAACCAGTTCTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009269.2-883s1c1
Sequence:CCGGGAGCACTATGGGATCAGTATTCTCGAGAATACTGATCCCATAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-883s21c1
Sequence:CCGGGAGCACTATGGGATCAGTATTCTCGAGAATACTGATCCCATAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-2275s21c1
Sequence:CCGGGCGAGCGTGTTGAGTGATATACTCGAGTATATCACTCAACACGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-243s21c1
Sequence:CCGGCCCTGCTCTCAACTACAACATCTCGAGATGTTGTAGTTGAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-1143s21c1
Sequence:CCGGACAAGGTGTTTCGGGTTTAAACTCGAGTTTAAACCCGAAACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-483s21c1
Sequence:CCGGGACCGAAGAAGCCATCATTTACTCGAGTAAATGATGGCTTCTTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009269
VALIDATED
SPTLC1 MISSION shRNA Lentiviral Transduction Particles
serine palmitoyltransferase, long chain base subunit 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009269.2-2275s1c1
Sequence:CCGGGCGAGCGTGTTGAGTGATATACTCGAGTATATCACTCAACACGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009269.2-418s1c1
Sequence:CCGGCGAGGGTTCTATGGCACATTTCTCGAGAAATGTGCCATAGAACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009269.2-243s1c1
Sequence:CCGGCCCTGCTCTCAACTACAACATCTCGAGATGTTGTAGTTGAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009269.2-779s1c1
Sequence:CCGGCCCTTCCAGAACTGGTTAAATCTCGAGATTTAACCAGTTCTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009269.2-883s1c1
Sequence:CCGGGAGCACTATGGGATCAGTATTCTCGAGAATACTGATCCCATAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-883s21c1
Sequence:CCGGGAGCACTATGGGATCAGTATTCTCGAGAATACTGATCCCATAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-2275s21c1
Sequence:CCGGGCGAGCGTGTTGAGTGATATACTCGAGTATATCACTCAACACGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-243s21c1
Sequence:CCGGCCCTGCTCTCAACTACAACATCTCGAGATGTTGTAGTTGAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-1143s21c1
Sequence:CCGGACAAGGTGTTTCGGGTTTAAACTCGAGTTTAAACCCGAAACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009269.2-483s21c1
Sequence:CCGGGACCGAAGAAGCCATCATTTACTCGAGTAAATGATGGCTTCTTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks