EMAIL THIS PAGE TO A FRIEND

SPTLC2

serine palmitoyltransferase, long chain base subunit 2

Synonyms: HSN1C LCB2 LCB2A NSAN1C SPT2 hLCB2a
UniProtKB ID: O15270, Q16685
Gene ID:
Human(9517) Summary: This gene encodes a long chain base subunit of serine palmitoyltransferase. Serine palmitoyltransferase, which consists of two different subunits, is the key enzyme in sphingolipid biosynthesis. It catalyzes the pyridoxal-5-prime-phosphate-dependent condensation of L-serine and palmitoyl-CoA to 3-oxosphinganine. Mutations in this gene were identified in patients with hereditary sensory neuropathy type I. [provided by RefSeq, Mar 2011]
Mouse(20773) serine palmitoyltransferase, long chain base subunit 2
Rat(366697) serine palmitoyltransferase, long chain base subunit 2
chicken(423379) serine palmitoyltransferase, long chain base subunit 2
dog(480403) serine palmitoyltransferase, long chain base subunit 2
Horse(100059392) serine palmitoyltransferase, long chain base subunit 2
domestic cat(101081055) serine palmitoyltransferase, long chain base subunit 2
domestic guinea pig(100719612) serine palmitoyltransferase, long chain base subunit 2
naked mole-rat(101702355) serine palmitoyltransferase, long chain base subunit 2
Domestic Rabbit(100358555) serine palmitoyltransferase, long chain base subunit 2
cow(537972) serine palmitoyltransferase, long chain base subunit 2
sheep(101115373) serine palmitoyltransferase, long chain base subunit 2
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C1159 L-Cycloserine pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004863 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120701 MISSION® esiRNA esiRNA human SPTLC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004863 Rosetta Predictions human pricing
NM_001037097 Rosetta Predictions rat pricing
NM_011479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338477 predicted 721
2 SASI_Hs01_00127968 predicted 1437
3 SASI_Hs01_00127969 predicted 727
4 SASI_Hs01_00127970 predicted 1364
5 SASI_Hs01_00127972 predicted 1049
6 SASI_Hs01_00127974 predicted 454
7 SASI_Hs01_00127975 predicted 1401
8 SASI_Hs02_00338478 predicted 1381
9 SASI_Hs01_00127976 predicted 1830
10 SASI_Hs02_00338479 predicted 871
11 SASI_Hs01_00127967 predicted 1498
12 SASI_Hs01_00127971 predicted 1300
13 SASI_Hs01_00127973 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109614 predicted 217
2 SASI_Rn01_00109615 predicted 1339
3 SASI_Rn01_00109616 predicted 1304
4 SASI_Rn01_00109617 predicted 582
5 SASI_Rn02_00204229 predicted 1742
6 SASI_Rn01_00109619 predicted 1419
7 SASI_Rn01_00109620 predicted 1266
8 SASI_Rn01_00109621 predicted 566
9 SASI_Rn01_00109622 predicted 312
10 SASI_Rn01_00109623 predicted 1400
11 SASI_Rn01_00109618 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320748 predicted 907
2 SASI_Mm01_00048936 predicted 760
3 SASI_Mm01_00048937 predicted 539
4 SASI_Mm02_00320749 predicted 1342
5 SASI_Mm01_00048940 predicted 1613
6 SASI_Mm01_00048941 predicted 869
7 SASI_Mm01_00048942 predicted 1262
8 SASI_Mm01_00048943 predicted 1501
9 SASI_Mm01_00048944 predicted 1522
10 SASI_Mm01_00048945 predicted 1373
11 SASI_Mm01_00048938 predicted 294
12 SASI_Mm01_00048939 predicted 1256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011479
VALIDATED
SPTLC2 MISSION shRNA Bacterial Glycerol Stock
serine palmitoyltransferase, long chain base subunit 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011479.3-1704s21c1
Sequence:CCGGCCCTTTGATGAGACTACCTATCTCGAGATAGGTAGTCTCATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011479.3-2734s21c1
Sequence:CCGGCCTCTTTCTTAAACTGGAATACTCGAGTATTCCAGTTTAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011479.3-1122s21c1
Sequence:CCGGCGAGGCGTGGTAGATTACTTTCTCGAGAAAGTAATCTACCACGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011479.3-1291s21c1
Sequence:CCGGCGCCTGTGATGGAACAGATTACTCGAGTAATCTGTTCCATCACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011479.2-2735s1c1
Sequence:CCGGCCTCTTTCTTAAACTGGAATACTCGAGTATTCCAGTTTAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011479.2-1291s1c1
Sequence:CCGGCCGCCTGTGATGGAACAGATTCTCGAGAATCTGTTCCATCACAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011479.2-1123s1c1
Sequence:CCGGCGAGGCGTGGTAGATTACTTTCTCGAGAAAGTAATCTACCACGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011479.2-1292s1c1
Sequence:CCGGCGCCTGTGATGGAACAGATTACTCGAGTAATCTGTTCCATCACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011479.2-1705s1c1
Sequence:CCGGCCCTTTGATGAGACTACCTATCTCGAGATAGGTAGTCTCATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011479
VALIDATED
SPTLC2 MISSION shRNA shRNA Plasmid DNA
serine palmitoyltransferase, long chain base subunit 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011479.3-1704s21c1
Sequence:CCGGCCCTTTGATGAGACTACCTATCTCGAGATAGGTAGTCTCATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011479.3-2734s21c1
Sequence:CCGGCCTCTTTCTTAAACTGGAATACTCGAGTATTCCAGTTTAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011479.3-1122s21c1
Sequence:CCGGCGAGGCGTGGTAGATTACTTTCTCGAGAAAGTAATCTACCACGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011479.3-1291s21c1
Sequence:CCGGCGCCTGTGATGGAACAGATTACTCGAGTAATCTGTTCCATCACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011479.2-2735s1c1
Sequence:CCGGCCTCTTTCTTAAACTGGAATACTCGAGTATTCCAGTTTAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011479.2-1291s1c1
Sequence:CCGGCCGCCTGTGATGGAACAGATTCTCGAGAATCTGTTCCATCACAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011479.2-1123s1c1
Sequence:CCGGCGAGGCGTGGTAGATTACTTTCTCGAGAAAGTAATCTACCACGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011479.2-1292s1c1
Sequence:CCGGCGCCTGTGATGGAACAGATTACTCGAGTAATCTGTTCCATCACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011479.2-1705s1c1
Sequence:CCGGCCCTTTGATGAGACTACCTATCTCGAGATAGGTAGTCTCATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011479
VALIDATED
SPTLC2 MISSION shRNA Lentiviral Transduction Particles
serine palmitoyltransferase, long chain base subunit 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011479.3-1704s21c1
Sequence:CCGGCCCTTTGATGAGACTACCTATCTCGAGATAGGTAGTCTCATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011479.3-2734s21c1
Sequence:CCGGCCTCTTTCTTAAACTGGAATACTCGAGTATTCCAGTTTAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011479.3-1122s21c1
Sequence:CCGGCGAGGCGTGGTAGATTACTTTCTCGAGAAAGTAATCTACCACGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011479.3-1291s21c1
Sequence:CCGGCGCCTGTGATGGAACAGATTACTCGAGTAATCTGTTCCATCACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011479.2-2735s1c1
Sequence:CCGGCCTCTTTCTTAAACTGGAATACTCGAGTATTCCAGTTTAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011479.2-1291s1c1
Sequence:CCGGCCGCCTGTGATGGAACAGATTCTCGAGAATCTGTTCCATCACAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011479.2-1123s1c1
Sequence:CCGGCGAGGCGTGGTAGATTACTTTCTCGAGAAAGTAATCTACCACGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011479.2-1292s1c1
Sequence:CCGGCGCCTGTGATGGAACAGATTACTCGAGTAATCTGTTCCATCACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011479.2-1705s1c1
Sequence:CCGGCCCTTTGATGAGACTACCTATCTCGAGATAGGTAGTCTCATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004863
VALIDATED
SPTLC2 MISSION shRNA Bacterial Glycerol Stock
serine palmitoyltransferase, long chain base subunit 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004863.2-1544s21c1
Sequence:CCGGCCTGAAAGAGATGGGCTTCATCTCGAGATGAAGCCCATCTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004863.2-1731s21c1
Sequence:CCGGGCTCATACCAAAGAAATACTTCTCGAGAAGTATTTCTTTGGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004863.2-1140s21c1
Sequence:CCGGTATAGCATGGAGGGATCTATTCTCGAGAATAGATCCCTCCATGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004863.2-1331s21c1
Sequence:CCGGTGGTGCTTCTGGAGGATATATCTCGAGATATATCCTCCAGAAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004863.2-2351s21c1
Sequence:CCGGCCAACCTTGGAATCCTTATTTCTCGAGAAATAAGGATTCCAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004863.2-858s1c1
Sequence:CCGGGCAAGGTTCTTAGGAGTAGAACTCGAGTTCTACTCCTAAGAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004863.2-1544s1c1
Sequence:CCGGCCTGAAAGAGATGGGCTTCATCTCGAGATGAAGCCCATCTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004863.2-447s1c1
Sequence:CCGGCTTCGAGATTTCTTGAGGTATCTCGAGATACCTCAAGAAATCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004863.2-1731s1c1
Sequence:CCGGGCTCATACCAAAGAAATACTTCTCGAGAAGTATTTCTTTGGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004863.2-1011s1c1
Sequence:CCGGGCAACCATTAGAATCTTCAAACTCGAGTTTGAAGATTCTAATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004863
VALIDATED
SPTLC2 MISSION shRNA shRNA Plasmid DNA
serine palmitoyltransferase, long chain base subunit 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004863.2-1544s21c1
Sequence:CCGGCCTGAAAGAGATGGGCTTCATCTCGAGATGAAGCCCATCTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004863.2-1731s21c1
Sequence:CCGGGCTCATACCAAAGAAATACTTCTCGAGAAGTATTTCTTTGGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004863.2-1140s21c1
Sequence:CCGGTATAGCATGGAGGGATCTATTCTCGAGAATAGATCCCTCCATGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004863.2-1331s21c1
Sequence:CCGGTGGTGCTTCTGGAGGATATATCTCGAGATATATCCTCCAGAAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004863.2-2351s21c1
Sequence:CCGGCCAACCTTGGAATCCTTATTTCTCGAGAAATAAGGATTCCAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004863.2-858s1c1
Sequence:CCGGGCAAGGTTCTTAGGAGTAGAACTCGAGTTCTACTCCTAAGAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004863.2-1544s1c1
Sequence:CCGGCCTGAAAGAGATGGGCTTCATCTCGAGATGAAGCCCATCTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004863.2-447s1c1
Sequence:CCGGCTTCGAGATTTCTTGAGGTATCTCGAGATACCTCAAGAAATCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004863.2-1731s1c1
Sequence:CCGGGCTCATACCAAAGAAATACTTCTCGAGAAGTATTTCTTTGGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004863.2-1011s1c1
Sequence:CCGGGCAACCATTAGAATCTTCAAACTCGAGTTTGAAGATTCTAATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004863
VALIDATED
SPTLC2 MISSION shRNA Lentiviral Transduction Particles
serine palmitoyltransferase, long chain base subunit 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004863.2-1544s21c1
Sequence:CCGGCCTGAAAGAGATGGGCTTCATCTCGAGATGAAGCCCATCTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004863.2-1731s21c1
Sequence:CCGGGCTCATACCAAAGAAATACTTCTCGAGAAGTATTTCTTTGGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004863.2-1140s21c1
Sequence:CCGGTATAGCATGGAGGGATCTATTCTCGAGAATAGATCCCTCCATGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004863.2-1331s21c1
Sequence:CCGGTGGTGCTTCTGGAGGATATATCTCGAGATATATCCTCCAGAAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004863.2-2351s21c1
Sequence:CCGGCCAACCTTGGAATCCTTATTTCTCGAGAAATAAGGATTCCAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004863.2-858s1c1
Sequence:CCGGGCAAGGTTCTTAGGAGTAGAACTCGAGTTCTACTCCTAAGAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004863.2-1544s1c1
Sequence:CCGGCCTGAAAGAGATGGGCTTCATCTCGAGATGAAGCCCATCTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004863.2-447s1c1
Sequence:CCGGCTTCGAGATTTCTTGAGGTATCTCGAGATACCTCAAGAAATCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004863.2-1731s1c1
Sequence:CCGGGCTCATACCAAAGAAATACTTCTCGAGAAGTATTTCTTTGGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004863.2-1011s1c1
Sequence:CCGGGCAACCATTAGAATCTTCAAACTCGAGTTTGAAGATTCTAATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks