EMAIL THIS PAGE TO A FRIEND

SPTLC3

serine palmitoyltransferase, long chain base subunit 3

Synonyms: C20orf38 LCB2B LCB3 SPT3 SPTLC2L dJ718P11 dJ718P11.1 hLCB2b
Gene ID:
Human(55304) Summary: The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]
Mouse(228677) serine palmitoyltransferase, long chain base subunit 3
Rat(296188) serine palmitoyltransferase, long chain base subunit 3
Zebrafish(445168) serine palmitoyltransferase, long chain base subunit 3
chicken(768538) serine palmitoyltransferase, long chain base subunit 3
dog(485766) serine palmitoyltransferase, long chain base subunit 3
Horse(100051200) serine palmitoyltransferase, long chain base subunit 3
domestic cat(101094257) serine palmitoyltransferase, long chain base subunit 3
cow(100336940) serine palmitoyltransferase, long chain base subunit 2
sheep(101110257) serine palmitoyltransferase, long chain base subunit 3
Domestic Rabbit(100339302) serine palmitoyltransferase, long chain base subunit 3
naked mole-rat(101702482) serine palmitoyltransferase, long chain base subunit 3
domestic guinea pig(100729009) serine palmitoyltransferase, long chain base subunit 3
172 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C1159 L-Cycloserine pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018327 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129941 MISSION® esiRNA esiRNA human SPTLC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018327 Rosetta Predictions human pricing
NM_001106517 Rosetta Predictions rat pricing
NM_175467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351761 predicted 1807
2 SASI_Hs02_00351762 predicted 727
3 SASI_Hs02_00351763 predicted 1273
4 SASI_Hs02_00351764 predicted 1816
5 SASI_Hs02_00351765 predicted 1006
6 SASI_Hs02_00351766 predicted 1506
7 SASI_Hs02_00351767 predicted 1920
8 SASI_Hs02_00351768 predicted 784
9 SASI_Hs02_00351769 predicted 323
10 SASI_Hs02_00351770 predicted 1571
11 SASI_Hs01_00059296 predicted 216
12 SASI_Hs01_00059297 predicted 494
13 SASI_Hs01_00059298 predicted 412
14 SASI_Hs01_00059299 predicted 486
15 SASI_Hs01_00059300 predicted 560
16 SASI_Hs01_00059301 predicted 568
17 SASI_Hs01_00059302 predicted 261
18 SASI_Hs01_00059303 predicted 483
19 SASI_Hs01_00059304 predicted 391
20 SASI_Hs01_00059305 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219738 predicted 1509
2 SASI_Rn02_00219739 predicted 458
3 SASI_Rn02_00219740 predicted 1428
4 SASI_Rn02_00219741 predicted 417
5 SASI_Rn02_00219742 predicted 380
6 SASI_Rn02_00219743 predicted 1461
7 SASI_Rn02_00219744 predicted 1966
8 SASI_Rn02_00219745 predicted 787
9 SASI_Rn02_00219746 predicted 1288
10 SASI_Rn02_00219747 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106300 predicted 732
2 SASI_Mm01_00106301 predicted 1607
3 SASI_Mm01_00106302 predicted 1734
4 SASI_Mm01_00106303 predicted 1195
5 SASI_Mm01_00106304 predicted 906
6 SASI_Mm01_00106305 predicted 1595
7 SASI_Mm01_00106306 predicted 1429
8 SASI_Mm01_00106307 predicted 611
9 SASI_Mm01_00106308 predicted 1292
10 SASI_Mm01_00106309 predicted 1394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018327
SPTLC3 MISSION shRNA Bacterial Glycerol Stock
serine palmitoyltransferase, long chain base subunit 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018327.1-131s1c1
Sequence:CCGGGCAATGGCTCACAAAGCAGAACTCGAGTTCTGCTTTGTGAGCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018327.1-1214s1c1
Sequence:CCGGCCAAATGAGAAGGAACCAGAACTCGAGTTCTGGTTCCTTCTCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018327.1-264s1c1
Sequence:CCGGCACTTACATGGGATATGGAATCTCGAGATTCCATATCCCATGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018327.1-554s1c1
Sequence:CCGGCAAACATCTCATGGGCAACTACTCGAGTAGTTGCCCATGAGATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018327.1-568s1c1
Sequence:CCGGGCAACTACTATTTGCCACATACTCGAGTATGTGGCAAATAGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018327.2-1438s21c1
Sequence:CCGGGAAGGACCTCGTGGATTATTTCTCGAGAAATAATCCACGAGGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018327.2-1927s21c1
Sequence:CCGGGAGCTTTGAACTCGAAGATTACTCGAGTAATCTTCGAGTTCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018327.2-1516s21c1
Sequence:CCGGGCAAATCATCAGATCACTAAACTCGAGTTTAGTGATCTGATGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018327
SPTLC3 MISSION shRNA shRNA Plasmid DNA
serine palmitoyltransferase, long chain base subunit 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018327.1-131s1c1
Sequence:CCGGGCAATGGCTCACAAAGCAGAACTCGAGTTCTGCTTTGTGAGCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018327.1-1214s1c1
Sequence:CCGGCCAAATGAGAAGGAACCAGAACTCGAGTTCTGGTTCCTTCTCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018327.1-264s1c1
Sequence:CCGGCACTTACATGGGATATGGAATCTCGAGATTCCATATCCCATGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018327.1-554s1c1
Sequence:CCGGCAAACATCTCATGGGCAACTACTCGAGTAGTTGCCCATGAGATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018327.1-568s1c1
Sequence:CCGGGCAACTACTATTTGCCACATACTCGAGTATGTGGCAAATAGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018327.2-1438s21c1
Sequence:CCGGGAAGGACCTCGTGGATTATTTCTCGAGAAATAATCCACGAGGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018327.2-1927s21c1
Sequence:CCGGGAGCTTTGAACTCGAAGATTACTCGAGTAATCTTCGAGTTCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018327.2-1516s21c1
Sequence:CCGGGCAAATCATCAGATCACTAAACTCGAGTTTAGTGATCTGATGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018327
SPTLC3 MISSION shRNA Lentiviral Transduction Particles
serine palmitoyltransferase, long chain base subunit 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018327.1-131s1c1
Sequence:CCGGGCAATGGCTCACAAAGCAGAACTCGAGTTCTGCTTTGTGAGCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018327.1-1214s1c1
Sequence:CCGGCCAAATGAGAAGGAACCAGAACTCGAGTTCTGGTTCCTTCTCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018327.1-264s1c1
Sequence:CCGGCACTTACATGGGATATGGAATCTCGAGATTCCATATCCCATGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018327.1-554s1c1
Sequence:CCGGCAAACATCTCATGGGCAACTACTCGAGTAGTTGCCCATGAGATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018327.1-568s1c1
Sequence:CCGGGCAACTACTATTTGCCACATACTCGAGTATGTGGCAAATAGTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018327.2-1438s21c1
Sequence:CCGGGAAGGACCTCGTGGATTATTTCTCGAGAAATAATCCACGAGGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018327.2-1927s21c1
Sequence:CCGGGAGCTTTGAACTCGAAGATTACTCGAGTAATCTTCGAGTTCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018327.2-1516s21c1
Sequence:CCGGGCAAATCATCAGATCACTAAACTCGAGTTTAGTGATCTGATGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175467
SPTLC3 MISSION shRNA Bacterial Glycerol Stock
serine palmitoyltransferase, long chain base subunit 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175467.1-1949s1c1
Sequence:CCGGCCTCTTTATCTCGAAAGTAATCTCGAGATTACTTTCGAGATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175467.1-1384s1c1
Sequence:CCGGGCAGTCACATAGCACTACTTACTCGAGTAAGTAGTGCTATGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175467.1-911s1c1
Sequence:CCGGGCAATGAATATCCCTGTATTTCTCGAGAAATACAGGGATATTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175467.1-1282s1c1
Sequence:CCGGCCCTGAAGATATTGACGTATACTCGAGTATACGTCAATATCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175467.1-910s1c1
Sequence:CCGGCGCAATGAATATCCCTGTATTCTCGAGAATACAGGGATATTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175467
SPTLC3 MISSION shRNA shRNA Plasmid DNA
serine palmitoyltransferase, long chain base subunit 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175467.1-1949s1c1
Sequence:CCGGCCTCTTTATCTCGAAAGTAATCTCGAGATTACTTTCGAGATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175467.1-1384s1c1
Sequence:CCGGGCAGTCACATAGCACTACTTACTCGAGTAAGTAGTGCTATGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175467.1-911s1c1
Sequence:CCGGGCAATGAATATCCCTGTATTTCTCGAGAAATACAGGGATATTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175467.1-1282s1c1
Sequence:CCGGCCCTGAAGATATTGACGTATACTCGAGTATACGTCAATATCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175467.1-910s1c1
Sequence:CCGGCGCAATGAATATCCCTGTATTCTCGAGAATACAGGGATATTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175467
SPTLC3 MISSION shRNA Lentiviral Transduction Particles
serine palmitoyltransferase, long chain base subunit 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175467.1-1949s1c1
Sequence:CCGGCCTCTTTATCTCGAAAGTAATCTCGAGATTACTTTCGAGATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175467.1-1384s1c1
Sequence:CCGGGCAGTCACATAGCACTACTTACTCGAGTAAGTAGTGCTATGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175467.1-911s1c1
Sequence:CCGGGCAATGAATATCCCTGTATTTCTCGAGAAATACAGGGATATTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175467.1-1282s1c1
Sequence:CCGGCCCTGAAGATATTGACGTATACTCGAGTATACGTCAATATCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175467.1-910s1c1
Sequence:CCGGCGCAATGAATATCCCTGTATTCTCGAGAATACAGGGATATTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks