EMAIL THIS PAGE TO A FRIEND

SPTSSA

serine palmitoyltransferase, small subunit A

Synonyms: C14orf147 SSSPTA
UniProtKB ID: Q969W0, B2RD54, D3DS93, Q8WTZ7
Gene ID:
Human(171546) Summary: Serine palmitoyltransferase (SPT; EC 2.3.1.50) catalyzes the first committed and rate-limiting step in sphingolipid biosynthesis. SSSPTA is a small SPT subunit that stimulates SPT activity and confers acyl-CoA preference to the SPT catalytic heterodimer of SPTLC1 (MIM 605712) and either SPTLC2 (MIM 605713) or SPTLC3 (MIM 611120) (Han et al., 2009 [PubMed 19416851]
Mouse(104725) serine palmitoyltransferase, small subunit A
Rat(500651) serine palmitoyltransferase, small subunit A
Zebrafish(541337) serine palmitoyltransferase, small subunit A
chicken(423318) serine palmitoyltransferase, small subunit A
domestic guinea pig(100724578) serine palmitoyltransferase, small subunit A
naked mole-rat(101717417) serine palmitoyltransferase, small subunit A
cow(615641) serine palmitoyltransferase, small subunit A
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138288 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138288 Rosetta Predictions human pricing
NM_001047743 Rosetta Predictions rat pricing
NM_134054 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064730 predicted 636
2 SASI_Hs01_00064732 predicted 415
3 SASI_Hs02_00363374 predicted 368
4 SASI_Hs01_00064733 predicted 646
5 SASI_Hs02_00363375 predicted 231
6 SASI_Hs01_00064735 predicted 238
7 SASI_Hs02_00363376 predicted 664
8 SASI_Hs01_00064736 predicted 314
9 SASI_Hs01_00064737 predicted 332
10 SASI_Hs01_00064739 predicted 335
11 SASI_Hs01_00064731 predicted 673
12 SASI_Hs01_00064734 predicted 778
13 SASI_Hs01_00064738 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206085 predicted 300
2 SASI_Rn02_00206086 predicted 461
3 SASI_Rn02_00206087 predicted 417
4 SASI_Rn02_00206088 predicted 608
5 SASI_Rn02_00206089 predicted 596
6 SASI_Rn02_00206090 predicted 329
7 SASI_Rn02_00206091 predicted 311
8 SASI_Rn02_00206092 predicted 329
9 SASI_Rn02_00206093 predicted 627
10 SASI_Rn02_00206094 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108752 predicted 723
2 SASI_Mm01_00108753 predicted 686
3 SASI_Mm01_00108754 predicted 677
4 SASI_Mm01_00108755 predicted 784
5 SASI_Mm02_00339221 predicted 696
6 SASI_Mm01_00108757 predicted 365
7 SASI_Mm01_00108758 predicted 267
8 SASI_Mm01_00108759 predicted 544
9 SASI_Mm01_00108760 predicted 618
10 SASI_Mm01_00108761 predicted 393
11 SASI_Mm01_00108756 predicted 600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138288
VALIDATED
SPTSSA MISSION shRNA Bacterial Glycerol Stock
serine palmitoyltransferase, small subunit A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138288.3-669s21c1
Sequence:CCGGATACATCTGCCTGGATATATTCTCGAGAATATATCCAGGCAGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138288.3-239s21c1
Sequence:CCGGGCGATATTGCACTACTTTGAACTCGAGTTCAAAGTAGTGCAATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138288.3-271s21c1
Sequence:CCGGACCAAGATGCGACCAGGATCACTCGAGTGATCCTGGTCGCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138288.3-199s21c1
Sequence:CCGGACTATACACAGGATACGTCTTCTCGAGAAGACGTATCCTGTGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138288.3-368s21c1
Sequence:CCGGCAACATAACCAACCTTATAAACTCGAGTTTATAAGGTTGGTTATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138288.3-247s21c1
Sequence:CCGGGCACTACTTTGAAATCGTACACTCGAGTGTACGATTTCAAAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_138288.2-333s1c1
Sequence:CCGGGCGATATTGCACTACTTTGAACTCGAGTTCAAAGTAGTGCAATATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138288.2-2171s1c1
Sequence:CCGGCCCATAGAGAACCACTAACAACTCGAGTTGTTAGTGGTTCTCTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138288.2-287s1c1
Sequence:CCGGGATGGCACTATACACAGGATACTCGAGTATCCTGTGTATAGTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138288.2-2331s1c1
Sequence:CCGGGCTGTTGTATAACTGATGGTTCTCGAGAACCATCAGTTATACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138288.2-341s1c1
Sequence:CCGGGCACTACTTTGAAATCGTACACTCGAGTGTACGATTTCAAAGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138288.2-260s1c1
Sequence:CCGGCAATTCCATGCTGGTTTCCATCTCGAGATGGAAACCAGCATGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138288
VALIDATED
SPTSSA MISSION shRNA shRNA Plasmid DNA
serine palmitoyltransferase, small subunit A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138288.3-669s21c1
Sequence:CCGGATACATCTGCCTGGATATATTCTCGAGAATATATCCAGGCAGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138288.3-239s21c1
Sequence:CCGGGCGATATTGCACTACTTTGAACTCGAGTTCAAAGTAGTGCAATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138288.3-271s21c1
Sequence:CCGGACCAAGATGCGACCAGGATCACTCGAGTGATCCTGGTCGCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138288.3-199s21c1
Sequence:CCGGACTATACACAGGATACGTCTTCTCGAGAAGACGTATCCTGTGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138288.3-368s21c1
Sequence:CCGGCAACATAACCAACCTTATAAACTCGAGTTTATAAGGTTGGTTATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138288.3-247s21c1
Sequence:CCGGGCACTACTTTGAAATCGTACACTCGAGTGTACGATTTCAAAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_138288.2-333s1c1
Sequence:CCGGGCGATATTGCACTACTTTGAACTCGAGTTCAAAGTAGTGCAATATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138288.2-2171s1c1
Sequence:CCGGCCCATAGAGAACCACTAACAACTCGAGTTGTTAGTGGTTCTCTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138288.2-287s1c1
Sequence:CCGGGATGGCACTATACACAGGATACTCGAGTATCCTGTGTATAGTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138288.2-2331s1c1
Sequence:CCGGGCTGTTGTATAACTGATGGTTCTCGAGAACCATCAGTTATACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138288.2-341s1c1
Sequence:CCGGGCACTACTTTGAAATCGTACACTCGAGTGTACGATTTCAAAGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138288.2-260s1c1
Sequence:CCGGCAATTCCATGCTGGTTTCCATCTCGAGATGGAAACCAGCATGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138288
VALIDATED
SPTSSA MISSION shRNA Lentiviral Transduction Particles
serine palmitoyltransferase, small subunit A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138288.3-669s21c1
Sequence:CCGGATACATCTGCCTGGATATATTCTCGAGAATATATCCAGGCAGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138288.3-239s21c1
Sequence:CCGGGCGATATTGCACTACTTTGAACTCGAGTTCAAAGTAGTGCAATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138288.3-271s21c1
Sequence:CCGGACCAAGATGCGACCAGGATCACTCGAGTGATCCTGGTCGCATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138288.3-199s21c1
Sequence:CCGGACTATACACAGGATACGTCTTCTCGAGAAGACGTATCCTGTGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138288.3-368s21c1
Sequence:CCGGCAACATAACCAACCTTATAAACTCGAGTTTATAAGGTTGGTTATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138288.3-247s21c1
Sequence:CCGGGCACTACTTTGAAATCGTACACTCGAGTGTACGATTTCAAAGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_138288.2-333s1c1
Sequence:CCGGGCGATATTGCACTACTTTGAACTCGAGTTCAAAGTAGTGCAATATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149901    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138288.2-2171s1c1
Sequence:CCGGCCCATAGAGAACCACTAACAACTCGAGTTGTTAGTGGTTCTCTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138288.2-287s1c1
Sequence:CCGGGATGGCACTATACACAGGATACTCGAGTATCCTGTGTATAGTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138288.2-2331s1c1
Sequence:CCGGGCTGTTGTATAACTGATGGTTCTCGAGAACCATCAGTTATACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138288.2-341s1c1
Sequence:CCGGGCACTACTTTGAAATCGTACACTCGAGTGTACGATTTCAAAGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138288.2-260s1c1
Sequence:CCGGCAATTCCATGCTGGTTTCCATCTCGAGATGGAAACCAGCATGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134054
VALIDATED
SPTSSA MISSION shRNA Bacterial Glycerol Stock
serine palmitoyltransferase, small subunit A
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134054.2-266s21c1
Sequence:CCGGCATCATGGCTATTCTGCATTACTCGAGTAATGCAGAATAGCCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134054.2-858s21c1
Sequence:CCGGCCCTAGACTCTTAACAGCTTTCTCGAGAAAGCTGTTAAGAGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215467    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134054.2-792s1c1
Sequence:CCGGGATACTTTGAGAACTACTTACCTCGAGGTAAGTAGTTCTCAAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134054.2-1162s1c1
Sequence:CCGGCATTTGCACGTTGTGATAAAGCTCGAGCTTTATCACAACGTGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134054.2-582s21c1
Sequence:CCGGCCTTTGTGACTGTTTCAATATCTCGAGATATTGAAACAGTCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134054.2-195s21c1
Sequence:CCGGGTGTTCAATTCGATGCTGGTTCTCGAGAACCAGCATCGAATTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134054.1-190s1c1
Sequence:CCGGCACATCATGGCTATTCTGCATCTCGAGATGCAGAATAGCCATGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134054.1-54s1c1
Sequence:CCGGGTCCTGGTTCTACTACCAGTACTCGAGTACTGGTAGTAGAACCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134054.1-121s1c1
Sequence:CCGGGTGTTCAATTCGATGCTGGTTCTCGAGAACCAGCATCGAATTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134054.1-192s1c1
Sequence:CCGGCATCATGGCTATTCTGCATTACTCGAGTAATGCAGAATAGCCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175376    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134054.1-784s1c1
Sequence:CCGGCCCTAGACTCTTAACAGCTTTCTCGAGAAAGCTGTTAAGAGTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134054.1-508s1c1
Sequence:CCGGCCTTTGTGACTGTTTCAATATCTCGAGATATTGAAACAGTCACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134054.1-186s1c1
Sequence:CCGGCCAGCACATCATGGCTATTCTCTCGAGAGAATAGCCATGATGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134054
VALIDATED
SPTSSA MISSION shRNA shRNA Plasmid DNA
serine palmitoyltransferase, small subunit A
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134054.2-266s21c1
Sequence:CCGGCATCATGGCTATTCTGCATTACTCGAGTAATGCAGAATAGCCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134054.2-858s21c1
Sequence:CCGGCCCTAGACTCTTAACAGCTTTCTCGAGAAAGCTGTTAAGAGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215467    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134054.2-792s1c1
Sequence:CCGGGATACTTTGAGAACTACTTACCTCGAGGTAAGTAGTTCTCAAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134054.2-1162s1c1
Sequence:CCGGCATTTGCACGTTGTGATAAAGCTCGAGCTTTATCACAACGTGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134054.2-582s21c1
Sequence:CCGGCCTTTGTGACTGTTTCAATATCTCGAGATATTGAAACAGTCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134054.2-195s21c1
Sequence:CCGGGTGTTCAATTCGATGCTGGTTCTCGAGAACCAGCATCGAATTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134054.1-190s1c1
Sequence:CCGGCACATCATGGCTATTCTGCATCTCGAGATGCAGAATAGCCATGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134054.1-54s1c1
Sequence:CCGGGTCCTGGTTCTACTACCAGTACTCGAGTACTGGTAGTAGAACCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134054.1-121s1c1
Sequence:CCGGGTGTTCAATTCGATGCTGGTTCTCGAGAACCAGCATCGAATTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134054.1-192s1c1
Sequence:CCGGCATCATGGCTATTCTGCATTACTCGAGTAATGCAGAATAGCCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175376    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134054.1-784s1c1
Sequence:CCGGCCCTAGACTCTTAACAGCTTTCTCGAGAAAGCTGTTAAGAGTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134054.1-508s1c1
Sequence:CCGGCCTTTGTGACTGTTTCAATATCTCGAGATATTGAAACAGTCACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134054.1-186s1c1
Sequence:CCGGCCAGCACATCATGGCTATTCTCTCGAGAGAATAGCCATGATGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134054
VALIDATED
SPTSSA MISSION shRNA Lentiviral Transduction Particles
serine palmitoyltransferase, small subunit A
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134054.2-266s21c1
Sequence:CCGGCATCATGGCTATTCTGCATTACTCGAGTAATGCAGAATAGCCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134054.2-858s21c1
Sequence:CCGGCCCTAGACTCTTAACAGCTTTCTCGAGAAAGCTGTTAAGAGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215467    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134054.2-792s1c1
Sequence:CCGGGATACTTTGAGAACTACTTACCTCGAGGTAAGTAGTTCTCAAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134054.2-1162s1c1
Sequence:CCGGCATTTGCACGTTGTGATAAAGCTCGAGCTTTATCACAACGTGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134054.2-582s21c1
Sequence:CCGGCCTTTGTGACTGTTTCAATATCTCGAGATATTGAAACAGTCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134054.2-195s21c1
Sequence:CCGGGTGTTCAATTCGATGCTGGTTCTCGAGAACCAGCATCGAATTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134054.1-190s1c1
Sequence:CCGGCACATCATGGCTATTCTGCATCTCGAGATGCAGAATAGCCATGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134054.1-54s1c1
Sequence:CCGGGTCCTGGTTCTACTACCAGTACTCGAGTACTGGTAGTAGAACCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134054.1-121s1c1
Sequence:CCGGGTGTTCAATTCGATGCTGGTTCTCGAGAACCAGCATCGAATTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134054.1-192s1c1
Sequence:CCGGCATCATGGCTATTCTGCATTACTCGAGTAATGCAGAATAGCCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175376    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134054.1-784s1c1
Sequence:CCGGCCCTAGACTCTTAACAGCTTTCTCGAGAAAGCTGTTAAGAGTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134054.1-508s1c1
Sequence:CCGGCCTTTGTGACTGTTTCAATATCTCGAGATATTGAAACAGTCACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134054.1-186s1c1
Sequence:CCGGCCAGCACATCATGGCTATTCTCTCGAGAGAATAGCCATGATGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks