EMAIL THIS PAGE TO A FRIEND

SPTSSB

serine palmitoyltransferase, small subunit B

Synonyms: ADMP C3orf57 SSSPTB
UniProtKB ID: Q8NFR3, B2R5D3, D3DNM8, Q0P5S6
Gene ID:
Human(165679) Summary: Serine palmitoyltransferase (SPT; EC 2.3.1.50) catalyzes the first committed and rate-limiting step in sphingolipid biosynthesis. SSSPTB is a small SPT subunit that stimulates SPT activity and confers acyl-CoA preference to the SPT catalytic heterodimer of SPTLC1 (MIM 605712) and either SPTLC2 (MIM 605713) or SPTLC3 (MIM 611120) (Han et al., 2009 [PubMed 19416851]
Mouse(66183) serine palmitoyltransferase, small subunit B
Rat(100362555) serine palmitoyltransferase, small subunit B
cow(780785) serine palmitoyltransferase, small subunit B
sheep(101103775) serine palmitoyltransferase, small subunit B
naked mole-rat(101708568) serine palmitoyltransferase, small subunit B
Zebrafish(678546) serine palmitoyltransferase, small subunit B
domestic cat(101092044) serine palmitoyltransferase, small subunit B
chicken(425008) serine palmitoyltransferase, small subunit B
dog(100683817) serine palmitoyltransferase, small subunit B
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047712 Anti-SPTSSB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145035 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118191 MISSION® esiRNA esiRNA human C3orf57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040100 Rosetta Predictions human pricing
NM_133675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066507 predicted 1419
2 SASI_Hs01_00066508 predicted 1014
3 SASI_Hs02_00308818 predicted 1201
4 SASI_Hs01_00066510 predicted 1117
5 SASI_Hs01_00066511 predicted 1055
6 SASI_Hs01_00066512 predicted 971
7 SASI_Hs01_00066513 predicted 1045
8 SASI_Hs01_00066516 predicted 1230
9 SASI_Hs02_00308819 predicted 972
10 SASI_Hs02_00308820 predicted 1043
11 SASI_Hs01_00066509 predicted 1229
12 SASI_Hs01_00066514 predicted 1344
13 SASI_Hs01_00066515 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093728 predicted 283
2 SASI_Mm01_00093729 predicted 466
3 SASI_Mm01_00093730 predicted 517
4 SASI_Mm01_00093731 predicted 449
5 SASI_Mm01_00093733 predicted 194
6 SASI_Mm01_00093734 predicted 372
7 SASI_Mm01_00093735 predicted 495
8 SASI_Mm01_00093736 predicted 388
9 SASI_Mm01_00093737 predicted 289
10 SASI_Mm02_00338633 predicted 480
11 SASI_Mm01_00093732 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133675
SPTSSB MISSION shRNA Bacterial Glycerol Stock
serine palmitoyltransferase, small subunit B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133675.1-371s1c1
Sequence:CCGGGTGGCTATGACAGTTCCATTTCTCGAGAAATGGAACTGTCATAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133675.1-279s1c1
Sequence:CCGGCATACTGACCATTGTGGCTATCTCGAGATAGCCACAATGGTCAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133675.1-270s1c1
Sequence:CCGGCAACACCATCATACTGACCATCTCGAGATGGTCAGTATGATGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133675.1-204s1c1
Sequence:CCGGGCTCTATTATCAATACCAGATCTCGAGATCTGGTATTGATAATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133675.1-1319s1c1
Sequence:CCGGGCTCCAGTTAAAGGCTTTGATCTCGAGATCAAAGCCTTTAACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133675.1-528s1c1
Sequence:CCGGGCCTGGAGTATGAGATAGGTTCTCGAGAACCTATCTCATACTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133675.1-375s1c1
Sequence:CCGGCTATGACAGTTCCATTTCTAACTCGAGTTAGAAATGGAACTGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216322    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133675.1-1586s1c1
Sequence:CCGGGACATCCAAAGAAAGTTATTTCTCGAGAAATAACTTTCTTTGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215517    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133675.1-711s1c1
Sequence:CCGGGACATGACAAAGTCATATTTACTCGAGTAAATATGACTTTGTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133675
SPTSSB MISSION shRNA shRNA Plasmid DNA
serine palmitoyltransferase, small subunit B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133675.1-371s1c1
Sequence:CCGGGTGGCTATGACAGTTCCATTTCTCGAGAAATGGAACTGTCATAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133675.1-279s1c1
Sequence:CCGGCATACTGACCATTGTGGCTATCTCGAGATAGCCACAATGGTCAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133675.1-270s1c1
Sequence:CCGGCAACACCATCATACTGACCATCTCGAGATGGTCAGTATGATGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133675.1-204s1c1
Sequence:CCGGGCTCTATTATCAATACCAGATCTCGAGATCTGGTATTGATAATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133675.1-1319s1c1
Sequence:CCGGGCTCCAGTTAAAGGCTTTGATCTCGAGATCAAAGCCTTTAACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133675.1-528s1c1
Sequence:CCGGGCCTGGAGTATGAGATAGGTTCTCGAGAACCTATCTCATACTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133675.1-375s1c1
Sequence:CCGGCTATGACAGTTCCATTTCTAACTCGAGTTAGAAATGGAACTGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216322    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133675.1-1586s1c1
Sequence:CCGGGACATCCAAAGAAAGTTATTTCTCGAGAAATAACTTTCTTTGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215517    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133675.1-711s1c1
Sequence:CCGGGACATGACAAAGTCATATTTACTCGAGTAAATATGACTTTGTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133675
SPTSSB MISSION shRNA Lentiviral Transduction Particles
serine palmitoyltransferase, small subunit B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133675.1-371s1c1
Sequence:CCGGGTGGCTATGACAGTTCCATTTCTCGAGAAATGGAACTGTCATAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133675.1-279s1c1
Sequence:CCGGCATACTGACCATTGTGGCTATCTCGAGATAGCCACAATGGTCAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133675.1-270s1c1
Sequence:CCGGCAACACCATCATACTGACCATCTCGAGATGGTCAGTATGATGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133675.1-204s1c1
Sequence:CCGGGCTCTATTATCAATACCAGATCTCGAGATCTGGTATTGATAATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133675.1-1319s1c1
Sequence:CCGGGCTCCAGTTAAAGGCTTTGATCTCGAGATCAAAGCCTTTAACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133675.1-528s1c1
Sequence:CCGGGCCTGGAGTATGAGATAGGTTCTCGAGAACCTATCTCATACTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133675.1-375s1c1
Sequence:CCGGCTATGACAGTTCCATTTCTAACTCGAGTTAGAAATGGAACTGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216322    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133675.1-1586s1c1
Sequence:CCGGGACATCCAAAGAAAGTTATTTCTCGAGAAATAACTTTCTTTGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215517    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133675.1-711s1c1
Sequence:CCGGGACATGACAAAGTCATATTTACTCGAGTAAATATGACTTTGTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145035
SPTSSB MISSION shRNA Bacterial Glycerol Stock
serine palmitoyltransferase, small subunit B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-739s1c1
Sequence:CCGGGCTTTAACGCAGCTTAGGCTACTCGAGTAGCCTAAGCTGCGTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-338s1c1
Sequence:CCGGCGAGATTAATTCTCTGCACTTCTCGAGAAGTGCAGAGAATTAATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-387s1c1
Sequence:CCGGCACGATCCTTTCATCTATTTCCTCGAGGAAATAGATGAAAGGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160797    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145035.2-2007s1c1
Sequence:CCGGCGGAGATAATACAGTGACTTTCTCGAGAAAGTCACTGTATTATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145035.2-2636s1c1
Sequence:CCGGCCGGAAGACAAGCTAATAAATCTCGAGATTTATTAGCTTGTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-336s1c1
Sequence:CCGGGCCGAGATTAATTCTCTGCACCTCGAGGTGCAGAGAATTAATCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-337s1c1
Sequence:CCGGCCGAGATTAATTCTCTGCACTCTCGAGAGTGCAGAGAATTAATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-740s1c1
Sequence:CCGGCTTTAACGCAGCTTAGGCTAACTCGAGTTAGCCTAAGCTGCGTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145035
SPTSSB MISSION shRNA shRNA Plasmid DNA
serine palmitoyltransferase, small subunit B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-739s1c1
Sequence:CCGGGCTTTAACGCAGCTTAGGCTACTCGAGTAGCCTAAGCTGCGTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-338s1c1
Sequence:CCGGCGAGATTAATTCTCTGCACTTCTCGAGAAGTGCAGAGAATTAATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-387s1c1
Sequence:CCGGCACGATCCTTTCATCTATTTCCTCGAGGAAATAGATGAAAGGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160797    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145035.2-2007s1c1
Sequence:CCGGCGGAGATAATACAGTGACTTTCTCGAGAAAGTCACTGTATTATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145035.2-2636s1c1
Sequence:CCGGCCGGAAGACAAGCTAATAAATCTCGAGATTTATTAGCTTGTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-336s1c1
Sequence:CCGGGCCGAGATTAATTCTCTGCACCTCGAGGTGCAGAGAATTAATCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-337s1c1
Sequence:CCGGCCGAGATTAATTCTCTGCACTCTCGAGAGTGCAGAGAATTAATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-740s1c1
Sequence:CCGGCTTTAACGCAGCTTAGGCTAACTCGAGTTAGCCTAAGCTGCGTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145035
SPTSSB MISSION shRNA Lentiviral Transduction Particles
serine palmitoyltransferase, small subunit B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-739s1c1
Sequence:CCGGGCTTTAACGCAGCTTAGGCTACTCGAGTAGCCTAAGCTGCGTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-338s1c1
Sequence:CCGGCGAGATTAATTCTCTGCACTTCTCGAGAAGTGCAGAGAATTAATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-387s1c1
Sequence:CCGGCACGATCCTTTCATCTATTTCCTCGAGGAAATAGATGAAAGGATCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160797    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145035.2-2007s1c1
Sequence:CCGGCGGAGATAATACAGTGACTTTCTCGAGAAAGTCACTGTATTATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145035.2-2636s1c1
Sequence:CCGGCCGGAAGACAAGCTAATAAATCTCGAGATTTATTAGCTTGTCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-336s1c1
Sequence:CCGGGCCGAGATTAATTCTCTGCACCTCGAGGTGCAGAGAATTAATCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-337s1c1
Sequence:CCGGCCGAGATTAATTCTCTGCACTCTCGAGAGTGCAGAGAATTAATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145035.2-740s1c1
Sequence:CCGGCTTTAACGCAGCTTAGGCTAACTCGAGTTAGCCTAAGCTGCGTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks