EMAIL THIS PAGE TO A FRIEND

SPTY2D1

SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)

Gene ID:
Mouse(101685) SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Rat(500144) SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Zebrafish(337191) SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Horse(100057181) SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
domestic cat(101080914) SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
dog(476884) SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
chicken(423083) SPT2, Suppressor of Ty, domain containing 1
domestic guinea pig(100712596) SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
naked mole-rat(101709521) SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
cow(539967) SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
sheep(101116776) SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
186 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175318 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175318 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175318 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_194285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194285 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_084736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_084736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_084736 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194285 Rosetta Predictions human pricing
XM_001080836 Rosetta Predictions rat pricing
XM_575496 Rosetta Predictions rat pricing
NM_175318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144689 predicted 794
2 SASI_Hs01_00144690 predicted 491
3 SASI_Hs01_00144691 predicted 1380
4 SASI_Hs01_00144693 predicted 765
5 SASI_Hs01_00144694 predicted 962
6 SASI_Hs01_00144695 predicted 823
7 SASI_Hs02_00371413 predicted 439
8 SASI_Hs01_00144696 predicted 2063
9 SASI_Hs01_00144697 predicted 711
10 SASI_Hs01_00144698 predicted 1086
11 SASI_Hs01_00144692 predicted 2199
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369589 predicted 655
2 SASI_Rn02_00369590 predicted 434
3 SASI_Rn02_00369591 predicted 855
4 SASI_Rn02_00369592 predicted 2267
5 SASI_Rn02_00369593 predicted 599
6 SASI_Rn02_00369594 predicted 460
7 SASI_Rn02_00369595 predicted 1052
8 SASI_Rn02_00369596 predicted 1326
9 SASI_Rn02_00369597 predicted 2356
10 SASI_Rn02_00369598 predicted 1504
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403762 predicted 228
2 SASI_Rn02_00403763 predicted 275
3 SASI_Rn02_00403764 predicted 231
4 SASI_Rn02_00403765 predicted 517
5 SASI_Rn02_00403766 predicted 425
6 SASI_Rn02_00403767 predicted 450
7 SASI_Rn02_00403768 predicted 276
8 SASI_Rn02_00403769 predicted 422
9 SASI_Rn02_00403770 predicted 419
10 SASI_Rn02_00403771 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083805 predicted 260
2 SASI_Mm01_00083806 predicted 892
3 SASI_Mm01_00083807 predicted 891
4 SASI_Mm01_00083808 predicted 1239
5 SASI_Mm01_00083809 predicted 224
6 SASI_Mm01_00083810 predicted 288
7 SASI_Mm01_00083811 predicted 1915
8 SASI_Mm01_00083812 predicted 1739
9 SASI_Mm01_00083813 predicted 353
10 SASI_Mm01_00083814 predicted 884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175318
VALIDATED
SPTY2D1 MISSION shRNA Bacterial Glycerol Stock
SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175318.4-2116s21c1
Sequence:CCGGATCCAAGCACATTCGAGAAATCTCGAGATTTCTCGAATGTGCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175318.4-2054s21c1
Sequence:CCGGGATGAATATGACTCGGAAATGCTCGAGCATTTCCGAGTCATATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175318.4-1916s21c1
Sequence:CCGGATTATTAGTCGGTCAAGTAATCTCGAGATTACTTGACCGACTAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175318.4-1559s21c1
Sequence:CCGGCGAACACTCAACGGCACAAATCTCGAGATTTGTGCCGTTGAGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175318.4-3883s21c1
Sequence:CCGGTGGTAGCAGAAAGTCTATTATCTCGAGATAATAGACTTTCTGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175318.3-3717s1c1
Sequence:CCGGCGTTAATATAAAGGGAGGAATCTCGAGATTCCTCCCTTTATATTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175318.3-211s1c1
Sequence:CCGGGCTTTCCTTAGGCGGAAAGAACTCGAGTTCTTTCCGCCTAAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175318.3-1720s1c1
Sequence:CCGGCGGTCAAGTAATGGACAGATACTCGAGTATCTGTCCATTACTTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175318
VALIDATED
SPTY2D1 MISSION shRNA shRNA Plasmid DNA
SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175318.4-2116s21c1
Sequence:CCGGATCCAAGCACATTCGAGAAATCTCGAGATTTCTCGAATGTGCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175318.4-2054s21c1
Sequence:CCGGGATGAATATGACTCGGAAATGCTCGAGCATTTCCGAGTCATATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175318.4-1916s21c1
Sequence:CCGGATTATTAGTCGGTCAAGTAATCTCGAGATTACTTGACCGACTAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175318.4-1559s21c1
Sequence:CCGGCGAACACTCAACGGCACAAATCTCGAGATTTGTGCCGTTGAGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175318.4-3883s21c1
Sequence:CCGGTGGTAGCAGAAAGTCTATTATCTCGAGATAATAGACTTTCTGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175318.3-3717s1c1
Sequence:CCGGCGTTAATATAAAGGGAGGAATCTCGAGATTCCTCCCTTTATATTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175318.3-211s1c1
Sequence:CCGGGCTTTCCTTAGGCGGAAAGAACTCGAGTTCTTTCCGCCTAAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175318.3-1720s1c1
Sequence:CCGGCGGTCAAGTAATGGACAGATACTCGAGTATCTGTCCATTACTTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175318
VALIDATED
SPTY2D1 MISSION shRNA Lentiviral Transduction Particles
SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175318.4-2116s21c1
Sequence:CCGGATCCAAGCACATTCGAGAAATCTCGAGATTTCTCGAATGTGCTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175318.4-2054s21c1
Sequence:CCGGGATGAATATGACTCGGAAATGCTCGAGCATTTCCGAGTCATATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175318.4-1916s21c1
Sequence:CCGGATTATTAGTCGGTCAAGTAATCTCGAGATTACTTGACCGACTAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175318.4-1559s21c1
Sequence:CCGGCGAACACTCAACGGCACAAATCTCGAGATTTGTGCCGTTGAGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175318.4-3883s21c1
Sequence:CCGGTGGTAGCAGAAAGTCTATTATCTCGAGATAATAGACTTTCTGCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175318.3-3717s1c1
Sequence:CCGGCGTTAATATAAAGGGAGGAATCTCGAGATTCCTCCCTTTATATTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175318.3-211s1c1
Sequence:CCGGGCTTTCCTTAGGCGGAAAGAACTCGAGTTCTTTCCGCCTAAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175318.3-1720s1c1
Sequence:CCGGCGGTCAAGTAATGGACAGATACTCGAGTATCTGTCCATTACTTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194285
SPTY2D1 MISSION shRNA Bacterial Glycerol Stock
SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194285.2-4367s21c1
Sequence:GTACCGGTGTTGATTTGCGTCAACATTACTCGAGTAATGTTGACGCAAATCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194285.2-713s21c1
Sequence:CCGGCCATGAACTTCACTGATTTACCTCGAGGTAAATCAGTGAAGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194285.2-474s21c1
Sequence:CCGGCAAGAGGACAAAGGATAATTTCTCGAGAAATTATCCTTTGTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194285.2-1432s21c1
Sequence:CCGGTCAGGACCTGAGCGATCAATCCTCGAGGATTGATCGCTCAGGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194285.2-1791s21c1
Sequence:CCGGTAGCTCAGGTCCCACTATAAACTCGAGTTTATAGTGGGACCTGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194285
SPTY2D1 MISSION shRNA shRNA Plasmid DNA
SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194285.2-4367s21c1
Sequence:GTACCGGTGTTGATTTGCGTCAACATTACTCGAGTAATGTTGACGCAAATCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194285.2-713s21c1
Sequence:CCGGCCATGAACTTCACTGATTTACCTCGAGGTAAATCAGTGAAGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194285.2-474s21c1
Sequence:CCGGCAAGAGGACAAAGGATAATTTCTCGAGAAATTATCCTTTGTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194285.2-1432s21c1
Sequence:CCGGTCAGGACCTGAGCGATCAATCCTCGAGGATTGATCGCTCAGGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194285.2-1791s21c1
Sequence:CCGGTAGCTCAGGTCCCACTATAAACTCGAGTTTATAGTGGGACCTGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194285
SPTY2D1 MISSION shRNA Lentiviral Transduction Particles
SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194285.2-4367s21c1
Sequence:GTACCGGTGTTGATTTGCGTCAACATTACTCGAGTAATGTTGACGCAAATCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194285.2-713s21c1
Sequence:CCGGCCATGAACTTCACTGATTTACCTCGAGGTAAATCAGTGAAGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194285.2-474s21c1
Sequence:CCGGCAAGAGGACAAAGGATAATTTCTCGAGAAATTATCCTTTGTCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194285.2-1432s21c1
Sequence:CCGGTCAGGACCTGAGCGATCAATCCTCGAGGATTGATCGCTCAGGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194285.2-1791s21c1
Sequence:CCGGTAGCTCAGGTCCCACTATAAACTCGAGTTTATAGTGGGACCTGAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_084736
VALIDATED
SPTY2D1 MISSION shRNA Bacterial Glycerol Stock
SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084736.7-1741s1c1
Sequence:CCGGCTGGACGGACTGTCAGTAATTCTCGAGAATTACTGACAGTCCGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084736.7-669s1c1
Sequence:CCGGGAAGAGCAAGAACCTCCCAAACTCGAGTTTGGGAGGTTCTTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:XM_084736.7-2066s1c1
Sequence:CCGGGCCTCAGGAAGAAATATCCAACTCGAGTTGGATATTTCTTCCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:XM_084736.7-1022s1c1
Sequence:CCGGGAAGAAATCAAGACCCAGCATCTCGAGATGCTGGGTCTTGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084736.7-1715s1c1
Sequence:CCGGGAGATCCATAAGTGGCTCAATCTCGAGATTGAGCCACTTATGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_084736
VALIDATED
SPTY2D1 MISSION shRNA shRNA Plasmid DNA
SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084736.7-1741s1c1
Sequence:CCGGCTGGACGGACTGTCAGTAATTCTCGAGAATTACTGACAGTCCGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084736.7-669s1c1
Sequence:CCGGGAAGAGCAAGAACCTCCCAAACTCGAGTTTGGGAGGTTCTTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:XM_084736.7-2066s1c1
Sequence:CCGGGCCTCAGGAAGAAATATCCAACTCGAGTTGGATATTTCTTCCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:XM_084736.7-1022s1c1
Sequence:CCGGGAAGAAATCAAGACCCAGCATCTCGAGATGCTGGGTCTTGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084736.7-1715s1c1
Sequence:CCGGGAGATCCATAAGTGGCTCAATCTCGAGATTGAGCCACTTATGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_084736
VALIDATED
SPTY2D1 MISSION shRNA Lentiviral Transduction Particles
SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084736.7-1741s1c1
Sequence:CCGGCTGGACGGACTGTCAGTAATTCTCGAGAATTACTGACAGTCCGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084736.7-669s1c1
Sequence:CCGGGAAGAGCAAGAACCTCCCAAACTCGAGTTTGGGAGGTTCTTGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:XM_084736.7-2066s1c1
Sequence:CCGGGCCTCAGGAAGAAATATCCAACTCGAGTTGGATATTTCTTCCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:XM_084736.7-1022s1c1
Sequence:CCGGGAAGAAATCAAGACCCAGCATCTCGAGATGCTGGGTCTTGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_084736.7-1715s1c1
Sequence:CCGGGAGATCCATAAGTGGCTCAATCTCGAGATTGAGCCACTTATGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks