EMAIL THIS PAGE TO A FRIEND

SPZ1

spermatogenic leucine zipper 1

Synonyms: NYD-TSP1
UniProtKB ID: Q9BXG8, B2RA21, Q8N4P1, Q8N7E9
Gene ID:
Human(84654) Summary: This gene encodes a bHLH-zip transcription factor which functions in the mitogen-activate protein kinase (MAPK) signaling pathway. Because of its role in the upregulation of cell proliferation and tumorigenesis, this gene may serve as a target for Ras-induced tumor treatments. [provided by RefSeq, Oct 2011]
Mouse(79401) spermatogenic leucine zipper 1
Rat(499510) spermatogenic leucine zipper 1
domestic cat(101090168) spermatogenic leucine zipper 1
dog(488928) spermatogenic leucine zipper 1
cow(519496) spermatogenic leucine zipper 1
domestic guinea pig(101787876) spermatogenic leucine zipper 1
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030237 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030237 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030237 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032567 Rosetta Predictions human pricing
NM_001024297 Rosetta Predictions rat pricing
NM_030237 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045024 predicted 1397
2 SASI_Hs01_00045025 predicted 355
3 SASI_Hs01_00045026 predicted 1193
4 SASI_Hs01_00045028 predicted 390
5 SASI_Hs01_00045029 predicted 1303
6 SASI_Hs01_00045030 predicted 1149
7 SASI_Hs01_00045031 predicted 291
8 SASI_Hs01_00045032 predicted 1418
9 SASI_Hs01_00045033 predicted 1246
10 SASI_Hs02_00360084 predicted 562
11 SASI_Hs01_00045027 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202489 predicted 530
2 SASI_Rn01_00112292 predicted 278
3 SASI_Rn01_00112293 predicted 1294
4 SASI_Rn01_00112294 predicted 501
5 SASI_Rn01_00112295 predicted 1174
6 SASI_Rn01_00112296 predicted 1174
7 SASI_Rn01_00112297 predicted 1281
8 SASI_Rn01_00112298 predicted 841
9 SASI_Rn01_00112299 predicted 385
10 SASI_Rn02_00202490 predicted 236
11 SASI_Rn01_00112290 predicted 337
12 SASI_Rn01_00112291 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146444 predicted 781
2 SASI_Mm01_00146445 predicted 1064
3 SASI_Mm01_00146446 predicted 784
4 SASI_Mm01_00146447 predicted 819
5 SASI_Mm02_00336696 predicted 1140
6 SASI_Mm01_00146448 predicted 1126
7 SASI_Mm01_00146449 predicted 869
8 SASI_Mm01_00146451 predicted 1127
9 SASI_Mm02_00336697 predicted 1270
10 SASI_Mm02_00336698 predicted 395
11 SASI_Mm01_00146450 predicted 433
12 SASI_Mm01_00146452 predicted 567
13 SASI_Mm01_00146453 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032567
SPZ1 MISSION shRNA Bacterial Glycerol Stock
spermatogenic leucine zipper 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032567.2-1245s1c1
Sequence:CCGGGAAGCCAATTCAGATAAACTACTCGAGTAGTTTATCTGAATTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167005    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032567.2-1652s1c1
Sequence:CCGGGTTATGTAAGTCTGGTCTTTACTCGAGTAAAGACCAGACTTACATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032567.2-1677s1c1
Sequence:CCGGCCATTGTGTCTACATCAAGTTCTCGAGAACTTGATGTAGACACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032567.2-1408s21c1
Sequence:CCGGTGCAATACCCAGTTCAATATTCTCGAGAATATTGAACTGGGTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032567.2-1333s21c1
Sequence:CCGGCAAGCAATGAAGGGTACATTTCTCGAGAAATGTACCCTTCATTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032567.2-1544s21c1
Sequence:CCGGACTTGTCAGTCATGATCAATCCTCGAGGATTGATCATGACTGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032567.2-289s21c1
Sequence:CCGGACCATTGCCTTATTCGAAATTCTCGAGAATTTCGAATAAGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032567.2-815s21c1
Sequence:CCGGGAGATTTGGTAAATCGTTTAGCTCGAGCTAAACGATTTACCAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032567
SPZ1 MISSION shRNA shRNA Plasmid DNA
spermatogenic leucine zipper 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032567.2-1245s1c1
Sequence:CCGGGAAGCCAATTCAGATAAACTACTCGAGTAGTTTATCTGAATTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167005    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032567.2-1652s1c1
Sequence:CCGGGTTATGTAAGTCTGGTCTTTACTCGAGTAAAGACCAGACTTACATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032567.2-1677s1c1
Sequence:CCGGCCATTGTGTCTACATCAAGTTCTCGAGAACTTGATGTAGACACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032567.2-1408s21c1
Sequence:CCGGTGCAATACCCAGTTCAATATTCTCGAGAATATTGAACTGGGTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032567.2-1333s21c1
Sequence:CCGGCAAGCAATGAAGGGTACATTTCTCGAGAAATGTACCCTTCATTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032567.2-1544s21c1
Sequence:CCGGACTTGTCAGTCATGATCAATCCTCGAGGATTGATCATGACTGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032567.2-289s21c1
Sequence:CCGGACCATTGCCTTATTCGAAATTCTCGAGAATTTCGAATAAGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032567.2-815s21c1
Sequence:CCGGGAGATTTGGTAAATCGTTTAGCTCGAGCTAAACGATTTACCAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032567
SPZ1 MISSION shRNA Lentiviral Transduction Particles
spermatogenic leucine zipper 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032567.2-1245s1c1
Sequence:CCGGGAAGCCAATTCAGATAAACTACTCGAGTAGTTTATCTGAATTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167005    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032567.2-1652s1c1
Sequence:CCGGGTTATGTAAGTCTGGTCTTTACTCGAGTAAAGACCAGACTTACATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032567.2-1677s1c1
Sequence:CCGGCCATTGTGTCTACATCAAGTTCTCGAGAACTTGATGTAGACACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032567.2-1408s21c1
Sequence:CCGGTGCAATACCCAGTTCAATATTCTCGAGAATATTGAACTGGGTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032567.2-1333s21c1
Sequence:CCGGCAAGCAATGAAGGGTACATTTCTCGAGAAATGTACCCTTCATTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032567.2-1544s21c1
Sequence:CCGGACTTGTCAGTCATGATCAATCCTCGAGGATTGATCATGACTGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032567.2-289s21c1
Sequence:CCGGACCATTGCCTTATTCGAAATTCTCGAGAATTTCGAATAAGGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032567.2-815s21c1
Sequence:CCGGGAGATTTGGTAAATCGTTTAGCTCGAGCTAAACGATTTACCAAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030237
SPZ1 MISSION shRNA Bacterial Glycerol Stock
spermatogenic leucine zipper 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030237.2-1348s1c1
Sequence:CCGGCGCCAGAAGCAGATACAACTTCTCGAGAAGTTGTATCTGCTTCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030237.2-356s1c1
Sequence:CCGGCCCACCACCAAAGAATAGCATCTCGAGATGCTATTCTTTGGTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030237.2-1015s1c1
Sequence:CCGGCAGCCCTGCTAGAGAATGAATCTCGAGATTCATTCTCTAGCAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030237.2-874s1c1
Sequence:CCGGGCCAGAACGAAACCCAAGAAACTCGAGTTTCTTGGGTTTCGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030237.2-1238s1c1
Sequence:CCGGCCCGGATGTTTGCTTTACTAACTCGAGTTAGTAAAGCAAACATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030237.3-349s21c1
Sequence:CCGGCGAACTCTGGGATCACCATTTCTCGAGAAATGGTGATCCCAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030237.3-1195s21c1
Sequence:CCGGACAAGAAATGTCCGAAGTTAGCTCGAGCTAACTTCGGACATTTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030237.3-896s21c1
Sequence:CCGGTAACGAACTCAGCGAACTAATCTCGAGATTAGTTCGCTGAGTTCGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030237
SPZ1 MISSION shRNA shRNA Plasmid DNA
spermatogenic leucine zipper 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030237.2-1348s1c1
Sequence:CCGGCGCCAGAAGCAGATACAACTTCTCGAGAAGTTGTATCTGCTTCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030237.2-356s1c1
Sequence:CCGGCCCACCACCAAAGAATAGCATCTCGAGATGCTATTCTTTGGTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030237.2-1015s1c1
Sequence:CCGGCAGCCCTGCTAGAGAATGAATCTCGAGATTCATTCTCTAGCAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030237.2-874s1c1
Sequence:CCGGGCCAGAACGAAACCCAAGAAACTCGAGTTTCTTGGGTTTCGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030237.2-1238s1c1
Sequence:CCGGCCCGGATGTTTGCTTTACTAACTCGAGTTAGTAAAGCAAACATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030237.3-349s21c1
Sequence:CCGGCGAACTCTGGGATCACCATTTCTCGAGAAATGGTGATCCCAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030237.3-1195s21c1
Sequence:CCGGACAAGAAATGTCCGAAGTTAGCTCGAGCTAACTTCGGACATTTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030237.3-896s21c1
Sequence:CCGGTAACGAACTCAGCGAACTAATCTCGAGATTAGTTCGCTGAGTTCGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030237
SPZ1 MISSION shRNA Lentiviral Transduction Particles
spermatogenic leucine zipper 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030237.2-1348s1c1
Sequence:CCGGCGCCAGAAGCAGATACAACTTCTCGAGAAGTTGTATCTGCTTCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030237.2-356s1c1
Sequence:CCGGCCCACCACCAAAGAATAGCATCTCGAGATGCTATTCTTTGGTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030237.2-1015s1c1
Sequence:CCGGCAGCCCTGCTAGAGAATGAATCTCGAGATTCATTCTCTAGCAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030237.2-874s1c1
Sequence:CCGGGCCAGAACGAAACCCAAGAAACTCGAGTTTCTTGGGTTTCGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030237.2-1238s1c1
Sequence:CCGGCCCGGATGTTTGCTTTACTAACTCGAGTTAGTAAAGCAAACATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030237.3-349s21c1
Sequence:CCGGCGAACTCTGGGATCACCATTTCTCGAGAAATGGTGATCCCAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030237.3-1195s21c1
Sequence:CCGGACAAGAAATGTCCGAAGTTAGCTCGAGCTAACTTCGGACATTTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030237.3-896s21c1
Sequence:CCGGTAACGAACTCAGCGAACTAATCTCGAGATTAGTTCGCTGAGTTCGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks