EMAIL THIS PAGE TO A FRIEND

SQLE

squalene epoxidase

UniProtKB ID: Q14534, Q9UEK6
Gene ID:
Human(6713) Summary: Squalene epoxidase catalyzes the first oxygenation step in sterol biosynthesis and is thought to be one of the rate-limiting enzymes in this pathway. [provided by RefSeq, Jul 2008]
Mouse(20775) squalene epoxidase
Rat(29230) squalene epoxidase
chicken(420335) squalene epoxidase
dog(608021) squalene epoxidase
Horse(100067615) squalene epoxidase
domestic cat(101086537) squalene epoxidase
domestic guinea pig(100732653) squalene epoxidase
naked mole-rat(101709317) squalene epoxidase
cow(526535) squalene epoxidase
sheep(100125351) squalene epoxidase
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003129 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003129 Rosetta Predictions human pricing
NM_017136 Rosetta Predictions rat pricing
NM_009270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149248 predicted 2302
2 SASI_Hs02_00335118 predicted 1879
3 SASI_Hs01_00149249 predicted 2729
4 SASI_Hs02_00335119 predicted 2044
5 SASI_Hs02_00335120 predicted 1807
6 SASI_Hs01_00149250 predicted 2632
7 SASI_Hs01_00149252 predicted 2574
8 SASI_Hs01_00149255 predicted 1524
9 SASI_Hs02_00335121 predicted 1362
10 SASI_Hs01_00149256 predicted 1124
11 SASI_Hs01_00149247 predicted 1880
12 SASI_Hs01_00149251 predicted 2366
13 SASI_Hs01_00149253 predicted 2044
14 SASI_Hs01_00149254 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043765 predicted 261
2 SASI_Rn01_00043766 predicted 1807
3 SASI_Rn01_00043767 predicted 601
4 SASI_Rn01_00043768 predicted 1765
5 SASI_Rn02_00261382 predicted 804
6 SASI_Rn01_00043769 predicted 367
7 SASI_Rn01_00043770 predicted 780
8 SASI_Rn01_00043771 predicted 988
9 SASI_Rn01_00043772 predicted 834
10 SASI_Rn01_00043773 predicted 653
11 SASI_Rn01_00043764 predicted 1853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183215 predicted 1480
2 SASI_Mm01_00183216 predicted 1054
3 SASI_Mm01_00183217 predicted 1996
4 SASI_Mm01_00183218 predicted 1789
5 SASI_Mm01_00183219 predicted 1326
6 SASI_Mm01_00183220 predicted 1761
7 SASI_Mm01_00183221 predicted 1949
8 SASI_Mm01_00183222 predicted 1286
9 SASI_Mm01_00183223 predicted 1678
10 SASI_Mm01_00183224 predicted 1859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009270
VALIDATED
SQLE MISSION shRNA Bacterial Glycerol Stock
squalene epoxidase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009270.3-2335s21c1
Sequence:CCGGGCCACGTATTTCTGCTTCAAACTCGAGTTTGAAGCAGAAATACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009270.3-1314s21c1
Sequence:CCGGCCATCATATACATGGCTACATCTCGAGATGTAGCCATGTATATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009270.3-2566s21c1
Sequence:CCGGGCTTGTGTATAAGCATGTAAACTCGAGTTTACATGCTTATACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009270.3-1465s21c1
Sequence:CCGGGAGCCCAATGTAAAGTTTATACTCGAGTATAAACTTTACATTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009270.3-1738s21c1
Sequence:CCGGCCAGTTCTCATCTACCAGATTCTCGAGAATCTGGTAGATGAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-2566s1c1
Sequence:CCGGGCTTGTGTATAAGCATGTAAACTCGAGTTTACATGCTTATACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-1738s1c1
Sequence:CCGGCCAGTTCTCATCTACCAGATTCTCGAGAATCTGGTAGATGAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-2335s1c1
Sequence:CCGGGCCACGTATTTCTGCTTCAAACTCGAGTTTGAAGCAGAAATACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-1314s1c1
Sequence:CCGGCCATCATATACATGGCTACATCTCGAGATGTAGCCATGTATATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-1465s1c1
Sequence:CCGGGAGCCCAATGTAAAGTTTATACTCGAGTATAAACTTTACATTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009270
VALIDATED
SQLE MISSION shRNA shRNA Plasmid DNA
squalene epoxidase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009270.3-2335s21c1
Sequence:CCGGGCCACGTATTTCTGCTTCAAACTCGAGTTTGAAGCAGAAATACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009270.3-1314s21c1
Sequence:CCGGCCATCATATACATGGCTACATCTCGAGATGTAGCCATGTATATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009270.3-2566s21c1
Sequence:CCGGGCTTGTGTATAAGCATGTAAACTCGAGTTTACATGCTTATACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009270.3-1465s21c1
Sequence:CCGGGAGCCCAATGTAAAGTTTATACTCGAGTATAAACTTTACATTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009270.3-1738s21c1
Sequence:CCGGCCAGTTCTCATCTACCAGATTCTCGAGAATCTGGTAGATGAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-2566s1c1
Sequence:CCGGGCTTGTGTATAAGCATGTAAACTCGAGTTTACATGCTTATACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-1738s1c1
Sequence:CCGGCCAGTTCTCATCTACCAGATTCTCGAGAATCTGGTAGATGAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-2335s1c1
Sequence:CCGGGCCACGTATTTCTGCTTCAAACTCGAGTTTGAAGCAGAAATACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-1314s1c1
Sequence:CCGGCCATCATATACATGGCTACATCTCGAGATGTAGCCATGTATATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-1465s1c1
Sequence:CCGGGAGCCCAATGTAAAGTTTATACTCGAGTATAAACTTTACATTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009270
VALIDATED
SQLE MISSION shRNA Lentiviral Transduction Particles
squalene epoxidase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009270.3-2335s21c1
Sequence:CCGGGCCACGTATTTCTGCTTCAAACTCGAGTTTGAAGCAGAAATACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009270.3-1314s21c1
Sequence:CCGGCCATCATATACATGGCTACATCTCGAGATGTAGCCATGTATATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009270.3-2566s21c1
Sequence:CCGGGCTTGTGTATAAGCATGTAAACTCGAGTTTACATGCTTATACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009270.3-1465s21c1
Sequence:CCGGGAGCCCAATGTAAAGTTTATACTCGAGTATAAACTTTACATTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009270.3-1738s21c1
Sequence:CCGGCCAGTTCTCATCTACCAGATTCTCGAGAATCTGGTAGATGAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-2566s1c1
Sequence:CCGGGCTTGTGTATAAGCATGTAAACTCGAGTTTACATGCTTATACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-1738s1c1
Sequence:CCGGCCAGTTCTCATCTACCAGATTCTCGAGAATCTGGTAGATGAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-2335s1c1
Sequence:CCGGGCCACGTATTTCTGCTTCAAACTCGAGTTTGAAGCAGAAATACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-1314s1c1
Sequence:CCGGCCATCATATACATGGCTACATCTCGAGATGTAGCCATGTATATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009270.2-1465s1c1
Sequence:CCGGGAGCCCAATGTAAAGTTTATACTCGAGTATAAACTTTACATTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003129
VALIDATED
SQLE MISSION shRNA Bacterial Glycerol Stock
squalene epoxidase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003129.3-1866s21c1
Sequence:CCGGGCACCACAGTTTAAAGCAAATCTCGAGATTTGCTTTAAACTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003129.3-1641s21c1
Sequence:CCGGGCAGAGCCCAATGCAAAGTTTCTCGAGAAACTTTGCATTGGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003129.3-2334s21c1
Sequence:CCGGGCTCAGGCTCTTTATGAATTACTCGAGTAATTCATAAAGAGCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003129.3-2732s21c1
Sequence:CCGGATAGTACCATACCACTTATAACTCGAGTTATAAGTGGTATGGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003129.3-1113s21c1
Sequence:CCGGTTCGCCCTCTTCTCGGATATTCTCGAGAATATCCGAGAAGAGGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003129.2-1622s1c1
Sequence:CCGGGCTCAGGCTCTTTATGAATTACTCGAGTAATTCATAAAGAGCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003129.2-430s1c1
Sequence:CCGGCCTGCCTTTCATTGGCTTCTTCTCGAGAAGAAGCCAATGAAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003129.2-1738s1c1
Sequence:CCGGGCTTTCTGTATTGTCTCCTAACTCGAGTTAGGAGACAATACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003129.2-929s1c1
Sequence:CCGGGCAGAGCCCAATGCAAAGTTTCTCGAGAAACTTTGCATTGGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003129.2-1154s1c1
Sequence:CCGGGCACCACAGTTTAAAGCAAATCTCGAGATTTGCTTTAAACTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003129
VALIDATED
SQLE MISSION shRNA shRNA Plasmid DNA
squalene epoxidase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003129.3-1866s21c1
Sequence:CCGGGCACCACAGTTTAAAGCAAATCTCGAGATTTGCTTTAAACTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003129.3-1641s21c1
Sequence:CCGGGCAGAGCCCAATGCAAAGTTTCTCGAGAAACTTTGCATTGGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003129.3-2334s21c1
Sequence:CCGGGCTCAGGCTCTTTATGAATTACTCGAGTAATTCATAAAGAGCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003129.3-2732s21c1
Sequence:CCGGATAGTACCATACCACTTATAACTCGAGTTATAAGTGGTATGGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003129.3-1113s21c1
Sequence:CCGGTTCGCCCTCTTCTCGGATATTCTCGAGAATATCCGAGAAGAGGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003129.2-1622s1c1
Sequence:CCGGGCTCAGGCTCTTTATGAATTACTCGAGTAATTCATAAAGAGCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003129.2-430s1c1
Sequence:CCGGCCTGCCTTTCATTGGCTTCTTCTCGAGAAGAAGCCAATGAAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003129.2-1738s1c1
Sequence:CCGGGCTTTCTGTATTGTCTCCTAACTCGAGTTAGGAGACAATACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003129.2-929s1c1
Sequence:CCGGGCAGAGCCCAATGCAAAGTTTCTCGAGAAACTTTGCATTGGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003129.2-1154s1c1
Sequence:CCGGGCACCACAGTTTAAAGCAAATCTCGAGATTTGCTTTAAACTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003129
VALIDATED
SQLE MISSION shRNA Lentiviral Transduction Particles
squalene epoxidase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003129.3-1866s21c1
Sequence:CCGGGCACCACAGTTTAAAGCAAATCTCGAGATTTGCTTTAAACTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003129.3-1641s21c1
Sequence:CCGGGCAGAGCCCAATGCAAAGTTTCTCGAGAAACTTTGCATTGGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003129.3-2334s21c1
Sequence:CCGGGCTCAGGCTCTTTATGAATTACTCGAGTAATTCATAAAGAGCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003129.3-2732s21c1
Sequence:CCGGATAGTACCATACCACTTATAACTCGAGTTATAAGTGGTATGGTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003129.3-1113s21c1
Sequence:CCGGTTCGCCCTCTTCTCGGATATTCTCGAGAATATCCGAGAAGAGGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003129.2-1622s1c1
Sequence:CCGGGCTCAGGCTCTTTATGAATTACTCGAGTAATTCATAAAGAGCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003129.2-430s1c1
Sequence:CCGGCCTGCCTTTCATTGGCTTCTTCTCGAGAAGAAGCCAATGAAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003129.2-1738s1c1
Sequence:CCGGGCTTTCTGTATTGTCTCCTAACTCGAGTTAGGAGACAATACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003129.2-929s1c1
Sequence:CCGGGCAGAGCCCAATGCAAAGTTTCTCGAGAAACTTTGCATTGGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003129.2-1154s1c1
Sequence:CCGGGCACCACAGTTTAAAGCAAATCTCGAGATTTGCTTTAAACTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks