EMAIL THIS PAGE TO A FRIEND

SQRDL

sulfide quinone reductase-like (yeast)

Synonyms: PRO1975
UniProtKB ID: Q9Y6N5, Q9UQM8
Gene ID:
Human(58472) Summary: The protein encoded by this gene may function in mitochondria to catalyze the conversion of sulfide to persulfides, thereby decreasing toxic concencrations of sulfide. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2012]
Mouse(59010) sulfide quinone reductase-like (yeast)
Rat(691966) sulfide quinone reductase-like (yeast)
Zebrafish(550580) sulfide quinone reductase-like (yeast)
chicken(415445) sulfide quinone reductase-like (yeast)
dog(478289) sulfide quinone reductase-like (yeast)
domestic cat(101085805) sulfide quinone reductase-like (yeast)
Horse(100070480) sulfide quinone reductase-like (yeast)
cow(507858) sulfide quinone reductase-like (yeast)
sheep(101113498) sulfide quinone reductase-like (yeast)
naked mole-rat(101725445) sulfide quinone reductase-like (yeast)
Domestic Rabbit(100357085) sulfide quinone reductase-like (yeast)
domestic guinea pig(100735471) sulfide quinone reductase-like (yeast)
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021199 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021199 Rosetta Predictions human pricing
NM_001047913 Rosetta Predictions rat pricing
XM_001080417 Rosetta Predictions rat pricing
NM_021507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354783 predicted 853
2 SASI_Hs02_00354784 predicted 1174
3 SASI_Hs01_00200868 predicted 869
4 SASI_Hs01_00200869 predicted 1387
5 SASI_Hs01_00200870 predicted 597
6 SASI_Hs01_00200872 predicted 474
7 SASI_Hs01_00200873 predicted 1285
8 SASI_Hs01_00200874 predicted 1134
9 SASI_Hs02_00354785 predicted 299
10 SASI_Hs02_00354786 predicted 1173
11 SASI_Hs01_00200867 predicted 1133
12 SASI_Hs01_00200871 predicted 1033
13 SASI_Hs01_00200875 predicted 585
14 SASI_Hs01_00200876 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206742 predicted 224
2 SASI_Rn02_00206743 predicted 230
3 SASI_Rn02_00206744 predicted 290
4 SASI_Rn02_00206745 predicted 52
5 SASI_Rn02_00206746 predicted 89
6 SASI_Rn02_00206747 predicted 334
7 SASI_Rn02_00206748 predicted 264
8 SASI_Rn02_00206749 predicted 422
9 SASI_Rn02_00206750 predicted 326
10 SASI_Rn02_00206751 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367949 predicted 305
2 SASI_Rn02_00367950 predicted 694
3 SASI_Rn02_00367951 predicted 786
4 SASI_Rn02_00367952 predicted 432
5 SASI_Rn02_00367953 predicted 290
6 SASI_Rn02_00367954 predicted 319
7 SASI_Rn02_00367955 predicted 889
8 SASI_Rn02_00367956 predicted 601
9 SASI_Rn02_00367957 predicted 906
10 SASI_Rn02_00367958 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326226 predicted 1369
2 SASI_Mm01_00035945 predicted 1630
3 SASI_Mm01_00035946 predicted 1083
4 SASI_Mm01_00035947 predicted 539
5 SASI_Mm01_00035948 predicted 1575
6 SASI_Mm01_00035949 predicted 774
7 SASI_Mm01_00035950 predicted 1275
8 SASI_Mm01_00035951 predicted 754
9 SASI_Mm01_00035952 predicted 1641
10 SASI_Mm01_00035953 predicted 1741
11 SASI_Mm01_00035954 predicted 1392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021507
VALIDATED
SQRDL MISSION shRNA Bacterial Glycerol Stock
sulfide quinone reductase-like (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021507.4-1647s1c1
Sequence:CCGGGCGAATTACTATGTACCTAATCTCGAGATTAGGTACATAGTAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021507.4-861s1c1
Sequence:CCGGGCTGGACTATGAGAAGATTAACTCGAGTTAATCTTCTCATAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021507.4-1827s1c1
Sequence:CCGGGATTGACATGACAGATACAAACTCGAGTTTGTATCTGTCATGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021507.4-1268s1c1
Sequence:CCGGCGCATGTGATTCCTTATGAAACTCGAGTTTCATAAGGAATCACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021507.4-1386s1c1
Sequence:CCGGGCAGCATAAGAAATACCCGAACTCGAGTTCGGGTATTTCTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021507.5-1176s21c1
Sequence:CCGGGGACGTCTCTGTCAACTATAACTCGAGTTATAGTTGACAGAGACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021507.5-1827s21c1
Sequence:CCGGGATTGACATGACAGATACAAACTCGAGTTTGTATCTGTCATGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021507.5-1268s21c1
Sequence:CCGGCGCATGTGATTCCTTATGAAACTCGAGTTTCATAAGGAATCACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021507.5-861s21c1
Sequence:CCGGGCTGGACTATGAGAAGATTAACTCGAGTTAATCTTCTCATAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021507
VALIDATED
SQRDL MISSION shRNA shRNA Plasmid DNA
sulfide quinone reductase-like (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021507.4-1647s1c1
Sequence:CCGGGCGAATTACTATGTACCTAATCTCGAGATTAGGTACATAGTAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021507.4-861s1c1
Sequence:CCGGGCTGGACTATGAGAAGATTAACTCGAGTTAATCTTCTCATAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021507.4-1827s1c1
Sequence:CCGGGATTGACATGACAGATACAAACTCGAGTTTGTATCTGTCATGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021507.4-1268s1c1
Sequence:CCGGCGCATGTGATTCCTTATGAAACTCGAGTTTCATAAGGAATCACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021507.4-1386s1c1
Sequence:CCGGGCAGCATAAGAAATACCCGAACTCGAGTTCGGGTATTTCTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021507.5-1176s21c1
Sequence:CCGGGGACGTCTCTGTCAACTATAACTCGAGTTATAGTTGACAGAGACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021507.5-1827s21c1
Sequence:CCGGGATTGACATGACAGATACAAACTCGAGTTTGTATCTGTCATGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021507.5-1268s21c1
Sequence:CCGGCGCATGTGATTCCTTATGAAACTCGAGTTTCATAAGGAATCACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021507.5-861s21c1
Sequence:CCGGGCTGGACTATGAGAAGATTAACTCGAGTTAATCTTCTCATAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021507
VALIDATED
SQRDL MISSION shRNA Lentiviral Transduction Particles
sulfide quinone reductase-like (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021507.4-1647s1c1
Sequence:CCGGGCGAATTACTATGTACCTAATCTCGAGATTAGGTACATAGTAATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021507.4-861s1c1
Sequence:CCGGGCTGGACTATGAGAAGATTAACTCGAGTTAATCTTCTCATAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021507.4-1827s1c1
Sequence:CCGGGATTGACATGACAGATACAAACTCGAGTTTGTATCTGTCATGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021507.4-1268s1c1
Sequence:CCGGCGCATGTGATTCCTTATGAAACTCGAGTTTCATAAGGAATCACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021507.4-1386s1c1
Sequence:CCGGGCAGCATAAGAAATACCCGAACTCGAGTTCGGGTATTTCTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021507.5-1176s21c1
Sequence:CCGGGGACGTCTCTGTCAACTATAACTCGAGTTATAGTTGACAGAGACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021507.5-1827s21c1
Sequence:CCGGGATTGACATGACAGATACAAACTCGAGTTTGTATCTGTCATGTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021507.5-1268s21c1
Sequence:CCGGCGCATGTGATTCCTTATGAAACTCGAGTTTCATAAGGAATCACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021507.5-861s21c1
Sequence:CCGGGCTGGACTATGAGAAGATTAACTCGAGTTAATCTTCTCATAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021199
VALIDATED
SQRDL MISSION shRNA Bacterial Glycerol Stock
sulfide quinone reductase-like (yeast)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-949s1c1
Sequence:CCGGGCTTCATGTCACACCTCCAATCTCGAGATTGGAGGTGTGACATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-1306s1c1
Sequence:CCGGGCGCCTTTCCATGTATCTCATCTCGAGATGAGATACATGGAAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-838s1c1
Sequence:CCGGCCTCACTGTTAACTACAAGAACTCGAGTTCTTGTAGTTAACAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-1234s1c1
Sequence:CCGGCCGTGTGATTCTTGCTGAGTTCTCGAGAACTCAGCAAGAATCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-310s1c1
Sequence:CCGGGAGACATTTCTACCAGCCAATCTCGAGATTGGCTGGTAGAAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021199
VALIDATED
SQRDL MISSION shRNA shRNA Plasmid DNA
sulfide quinone reductase-like (yeast)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-949s1c1
Sequence:CCGGGCTTCATGTCACACCTCCAATCTCGAGATTGGAGGTGTGACATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-1306s1c1
Sequence:CCGGGCGCCTTTCCATGTATCTCATCTCGAGATGAGATACATGGAAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-838s1c1
Sequence:CCGGCCTCACTGTTAACTACAAGAACTCGAGTTCTTGTAGTTAACAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-1234s1c1
Sequence:CCGGCCGTGTGATTCTTGCTGAGTTCTCGAGAACTCAGCAAGAATCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-310s1c1
Sequence:CCGGGAGACATTTCTACCAGCCAATCTCGAGATTGGCTGGTAGAAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021199
VALIDATED
SQRDL MISSION shRNA Lentiviral Transduction Particles
sulfide quinone reductase-like (yeast)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-949s1c1
Sequence:CCGGGCTTCATGTCACACCTCCAATCTCGAGATTGGAGGTGTGACATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-1306s1c1
Sequence:CCGGGCGCCTTTCCATGTATCTCATCTCGAGATGAGATACATGGAAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-838s1c1
Sequence:CCGGCCTCACTGTTAACTACAAGAACTCGAGTTCTTGTAGTTAACAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-1234s1c1
Sequence:CCGGCCGTGTGATTCTTGCTGAGTTCTCGAGAACTCAGCAAGAATCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021199.1-310s1c1
Sequence:CCGGGAGACATTTCTACCAGCCAATCTCGAGATTGGCTGGTAGAAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks