EMAIL THIS PAGE TO A FRIEND

SQSTM1

sequestosome 1

Synonyms: A170 OSIL PDB3 ZIP3 p60 p62 p62B
Gene ID:
Human(8878) Summary: This gene encodes a multifunctional protein that binds ubiquitin and regulates activation of the nuclear factor kappa-B (NF-kB) signaling pathway. The protein functions as a scaffolding/adaptor protein in concert with TNF receptor-associated factor 6 to mediate activation of NF-kB in response to upstream signals. Alternatively spliced transcript variants encoding either the same or different isoforms have been identified for this gene. Mutations in this gene result in sporadic and familial Paget disease of bone. [provided by RefSeq, Mar 2009]
Mouse(18412) sequestosome 1
Rat(113894) sequestosome 1
Zebrafish(406452) sequestosome 1
dog(481459) sequestosome 1
Horse(100067231) sequestosome 1
domestic cat(101085431) sequestosome 1
chicken(770805) sequestosome 1
naked mole-rat(101724587) sequestosome 1
cow(338045) sequestosome 1
sheep(100135450) sequestosome 1
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003900 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011018 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011018 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011018 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003900 Rosetta Predictions human pricing
NM_175843 Rosetta Predictions rat pricing
NM_181550 Rosetta Predictions rat pricing
NM_011018 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118616 predicted 1132
2 SASI_Hs01_00118618 predicted 1219
3 SASI_Hs01_00118620 predicted 667
4 SASI_Hs01_00118621 predicted 1075
5 SASI_Hs02_00336523 predicted 1062
6 SASI_Hs02_00336524 predicted 1063
7 SASI_Hs01_00118624 predicted 328
8 SASI_Hs01_00118625 predicted 1902
9 SASI_Hs02_00336525 predicted 841
10 SASI_Hs02_00336526 predicted 1084
11 SASI_Hs01_00118617 predicted 325
12 SASI_Hs01_00118619 predicted 629
13 SASI_Hs01_00118622 predicted 776
14 SASI_Hs01_00118623 predicted 1839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269538 predicted 1495
2 SASI_Rn02_00269539 predicted 1649
3 SASI_Rn02_00269540 predicted 1394
4 SASI_Rn02_00269541 predicted 999
5 SASI_Rn02_00269542 predicted 721
6 SASI_Rn02_00269543 predicted 1475
7 SASI_Rn02_00269544 predicted 1492
8 SASI_Rn02_00269545 predicted 1480
9 SASI_Rn02_00269546 predicted 1046
10 SASI_Rn02_00269547 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098872 predicted 297
2 SASI_Rn01_00098873 predicted 249
3 SASI_Rn01_00098874 predicted 257
4 SASI_Rn01_00098875 predicted 206
5 SASI_Rn01_00098876 predicted 394
6 SASI_Rn01_00098877 predicted 394
7 SASI_Rn01_00098878 predicted 582
8 SASI_Rn01_00098879 predicted 363
9 SASI_Rn01_00098880 predicted 226
10 SASI_Rn01_00098881 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079384 predicted 724
2 SASI_Mm01_00079386 predicted 784
3 SASI_Mm02_00319740 predicted 307
4 SASI_Mm01_00079387 predicted 784
5 SASI_Mm01_00079388 predicted 711
6 SASI_Mm01_00079390 predicted 1072
7 SASI_Mm02_00319741 predicted 302
8 SASI_Mm01_00079391 predicted 315
9 SASI_Mm01_00079392 predicted 272
10 SASI_Mm02_00319742 predicted 260
11 SASI_Mm01_00079385 predicted 1393
12 SASI_Mm01_00079389 predicted 262
13 SASI_Mm01_00079393 predicted 1426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003900
VALIDATED
SQSTM1 MISSION shRNA Bacterial Glycerol Stock
sequestosome 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003900.4-1729s21c1
Sequence:CCGGTGCCTAATGGCTTTCACTTTCCTCGAGGAAAGTGAAAGCCATTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-783s21c1
Sequence:CCGGGAGGATCCGAGTGTGAATTTCCTCGAGGAAATTCACACTCGGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-1098s21c1
Sequence:CCGGGATGATGACTGGACCCATCTGCTCGAGCAGATGGGTCCAGTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-526s21c1
Sequence:CCGGTCTGCCCAGACTACGACTTGTCTCGAGACAAGTCGTAGTCTGGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-1157s21c1
Sequence:CCGGGTCCCTACAGATGCCAGAATCCTCGAGGATTCTGGCATCTGTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-653s21c1
Sequence:CCGGGAAGGTGAAACACGGACACTTCTCGAGAAGTGTCCGTGTTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-1380s21c1
Sequence:CCGGGACACCATCCAGTATTCAAAGCTCGAGCTTTGAATACTGGATGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003900.4-1452s21c1
Sequence:CCGGTCTGTCTCATAGTTGTGTTAACTCGAGTTAACACAACTATGAGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003900.2-788s1c1
Sequence:CCGGCCTCTGGGCATTGAAGTTGATCTCGAGATCAACTTCAATGCCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003900.2-2678s1c1
Sequence:CCGGGCCCTCCATTTGTAAGAACAACTCGAGTTGTTCTTACAAATGGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003900.2-280s1c1
Sequence:CCGGCGAGGAATTGACAATGGCCATCTCGAGATGGCCATTGTCAATTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003900.2-967s1c1
Sequence:CCGGGCAGATGAGAAAGATCGCCTTCTCGAGAAGGCGATCTTTCTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003900.2-325s1c1
Sequence:CCGGCCGAATCTACATTAAAGAGAACTCGAGTTCTCTTTAATGTAGATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003900
VALIDATED
SQSTM1 MISSION shRNA shRNA Plasmid DNA
sequestosome 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003900.4-1729s21c1
Sequence:CCGGTGCCTAATGGCTTTCACTTTCCTCGAGGAAAGTGAAAGCCATTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-783s21c1
Sequence:CCGGGAGGATCCGAGTGTGAATTTCCTCGAGGAAATTCACACTCGGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-1098s21c1
Sequence:CCGGGATGATGACTGGACCCATCTGCTCGAGCAGATGGGTCCAGTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-526s21c1
Sequence:CCGGTCTGCCCAGACTACGACTTGTCTCGAGACAAGTCGTAGTCTGGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-1157s21c1
Sequence:CCGGGTCCCTACAGATGCCAGAATCCTCGAGGATTCTGGCATCTGTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-653s21c1
Sequence:CCGGGAAGGTGAAACACGGACACTTCTCGAGAAGTGTCCGTGTTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-1380s21c1
Sequence:CCGGGACACCATCCAGTATTCAAAGCTCGAGCTTTGAATACTGGATGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003900.4-1452s21c1
Sequence:CCGGTCTGTCTCATAGTTGTGTTAACTCGAGTTAACACAACTATGAGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003900.2-788s1c1
Sequence:CCGGCCTCTGGGCATTGAAGTTGATCTCGAGATCAACTTCAATGCCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003900.2-2678s1c1
Sequence:CCGGGCCCTCCATTTGTAAGAACAACTCGAGTTGTTCTTACAAATGGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003900.2-280s1c1
Sequence:CCGGCGAGGAATTGACAATGGCCATCTCGAGATGGCCATTGTCAATTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003900.2-967s1c1
Sequence:CCGGGCAGATGAGAAAGATCGCCTTCTCGAGAAGGCGATCTTTCTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003900.2-325s1c1
Sequence:CCGGCCGAATCTACATTAAAGAGAACTCGAGTTCTCTTTAATGTAGATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003900
VALIDATED
SQSTM1 MISSION shRNA Lentiviral Transduction Particles
sequestosome 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003900.4-1729s21c1
Sequence:CCGGTGCCTAATGGCTTTCACTTTCCTCGAGGAAAGTGAAAGCCATTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-783s21c1
Sequence:CCGGGAGGATCCGAGTGTGAATTTCCTCGAGGAAATTCACACTCGGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-1098s21c1
Sequence:CCGGGATGATGACTGGACCCATCTGCTCGAGCAGATGGGTCCAGTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-526s21c1
Sequence:CCGGTCTGCCCAGACTACGACTTGTCTCGAGACAAGTCGTAGTCTGGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-1157s21c1
Sequence:CCGGGTCCCTACAGATGCCAGAATCCTCGAGGATTCTGGCATCTGTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-653s21c1
Sequence:CCGGGAAGGTGAAACACGGACACTTCTCGAGAAGTGTCCGTGTTTCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003900.4-1380s21c1
Sequence:CCGGGACACCATCCAGTATTCAAAGCTCGAGCTTTGAATACTGGATGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003900.4-1452s21c1
Sequence:CCGGTCTGTCTCATAGTTGTGTTAACTCGAGTTAACACAACTATGAGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003900.2-788s1c1
Sequence:CCGGCCTCTGGGCATTGAAGTTGATCTCGAGATCAACTTCAATGCCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003900.2-2678s1c1
Sequence:CCGGGCCCTCCATTTGTAAGAACAACTCGAGTTGTTCTTACAAATGGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003900.2-280s1c1
Sequence:CCGGCGAGGAATTGACAATGGCCATCTCGAGATGGCCATTGTCAATTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003900.2-967s1c1
Sequence:CCGGGCAGATGAGAAAGATCGCCTTCTCGAGAAGGCGATCTTTCTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003900.2-325s1c1
Sequence:CCGGCCGAATCTACATTAAAGAGAACTCGAGTTCTCTTTAATGTAGATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011018
VALIDATED
SQSTM1 MISSION shRNA Bacterial Glycerol Stock
sequestosome 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011018.2-435s21c1
Sequence:CCGGTGTGGTGGGAACTCGCTATAACTCGAGTTATAGCGAGTTCCCACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011018.2-1345s21c1
Sequence:CCGGCACCCTCCACCATTGTGATAGCTCGAGCTATCACAATGGTGGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011018.2-1720s21c1
Sequence:CCGGTAGTACAACTGCTAGTTATTTCTCGAGAAATAACTAGCAGTTGTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011018.2-1041s21c1
Sequence:CCGGAGACGATGACTGGACACATTTCTCGAGAAATGTGTCCAGTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011018.2-1101s21c1
Sequence:CCGGGTCTCTACAGATGCCAGAATCCTCGAGGATTCTGGCATCTGTAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011018.1-1386s1c1
Sequence:CCGGCCCTTTGTCTTGTAGTTGCATCTCGAGATGCAACTACAAGACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011018.1-289s1c1
Sequence:CCGGGCTATGTCCTATGTGAAAGATCTCGAGATCTTTCACATAGGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011018.1-793s1c1
Sequence:CCGGGAGGTTGACATTGATGTGGAACTCGAGTTCCACATCAATGTCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011018.1-1284s1c1
Sequence:CCGGGCTCCTACAGACCAAGAATTACTCGAGTAATTCTTGGTCTGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011018.1-318s1c1
Sequence:CCGGCCGCATCTACATTAAAGAGAACTCGAGTTCTCTTTAATGTAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011018
VALIDATED
SQSTM1 MISSION shRNA shRNA Plasmid DNA
sequestosome 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011018.2-435s21c1
Sequence:CCGGTGTGGTGGGAACTCGCTATAACTCGAGTTATAGCGAGTTCCCACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011018.2-1345s21c1
Sequence:CCGGCACCCTCCACCATTGTGATAGCTCGAGCTATCACAATGGTGGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011018.2-1720s21c1
Sequence:CCGGTAGTACAACTGCTAGTTATTTCTCGAGAAATAACTAGCAGTTGTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011018.2-1041s21c1
Sequence:CCGGAGACGATGACTGGACACATTTCTCGAGAAATGTGTCCAGTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011018.2-1101s21c1
Sequence:CCGGGTCTCTACAGATGCCAGAATCCTCGAGGATTCTGGCATCTGTAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011018.1-1386s1c1
Sequence:CCGGCCCTTTGTCTTGTAGTTGCATCTCGAGATGCAACTACAAGACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011018.1-289s1c1
Sequence:CCGGGCTATGTCCTATGTGAAAGATCTCGAGATCTTTCACATAGGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011018.1-793s1c1
Sequence:CCGGGAGGTTGACATTGATGTGGAACTCGAGTTCCACATCAATGTCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011018.1-1284s1c1
Sequence:CCGGGCTCCTACAGACCAAGAATTACTCGAGTAATTCTTGGTCTGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011018.1-318s1c1
Sequence:CCGGCCGCATCTACATTAAAGAGAACTCGAGTTCTCTTTAATGTAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011018
VALIDATED
SQSTM1 MISSION shRNA Lentiviral Transduction Particles
sequestosome 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011018.2-435s21c1
Sequence:CCGGTGTGGTGGGAACTCGCTATAACTCGAGTTATAGCGAGTTCCCACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011018.2-1345s21c1
Sequence:CCGGCACCCTCCACCATTGTGATAGCTCGAGCTATCACAATGGTGGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011018.2-1720s21c1
Sequence:CCGGTAGTACAACTGCTAGTTATTTCTCGAGAAATAACTAGCAGTTGTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011018.2-1041s21c1
Sequence:CCGGAGACGATGACTGGACACATTTCTCGAGAAATGTGTCCAGTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011018.2-1101s21c1
Sequence:CCGGGTCTCTACAGATGCCAGAATCCTCGAGGATTCTGGCATCTGTAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011018.1-1386s1c1
Sequence:CCGGCCCTTTGTCTTGTAGTTGCATCTCGAGATGCAACTACAAGACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011018.1-289s1c1
Sequence:CCGGGCTATGTCCTATGTGAAAGATCTCGAGATCTTTCACATAGGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011018.1-793s1c1
Sequence:CCGGGAGGTTGACATTGATGTGGAACTCGAGTTCCACATCAATGTCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011018.1-1284s1c1
Sequence:CCGGGCTCCTACAGACCAAGAATTACTCGAGTAATTCTTGGTCTGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011018.1-318s1c1
Sequence:CCGGCCGCATCTACATTAAAGAGAACTCGAGTTCTCTTTAATGTAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks