EMAIL THIS PAGE TO A FRIEND

SRA1

steroid receptor RNA activator 1

Synonyms: SRA SRAP STRAA1 pp7684
UniProtKB ID: Q9HD15, Q6NVU9, Q8IXM1, Q9HD13, Q9HD14
Gene ID:
Human(10011) Summary: Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]
Mouse(24068) steroid receptor RNA activator 1
Rat(252891) steroid receptor RNA activator 1
Zebrafish(415137) steroid receptor RNA activator 1
domestic cat(101091752) steroid receptor RNA activator 1
dog(606944) steroid receptor RNA activator 1
cow(780787) steroid receptor RNA activator 1
sheep(101118694) steroid receptor RNA activator 1
naked mole-rat(101706327) steroid receptor RNA activator 1
domestic guinea pig(100734470) steroid receptor RNA activator 1
Gene Class: Apoptosis
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025291 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025291 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025291 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001035235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001035235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001035235 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035235 Rosetta Predictions human pricing
XM_925998 Rosetta Predictions human pricing
NM_183329 Rosetta Predictions rat pricing
NM_025291 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308170 predicted 1334
2 SASI_Hs02_00308171 predicted 1452
3 SASI_Hs02_00308172 predicted 1467
4 SASI_Hs02_00308173 predicted 1651
5 SASI_Hs01_00210573 predicted 895
6 SASI_Hs01_00210574 predicted 1175
7 SASI_Hs01_00210575 predicted 979
8 SASI_Hs01_00210576 predicted 946
9 SASI_Hs01_00210577 predicted 982
10 SASI_Hs01_00210578 predicted 683
11 SASI_Hs01_00210579 predicted 1093
12 SASI_Hs01_00210580 predicted 1154
13 SASI_Hs01_00210581 predicted 1087
14 SASI_Hs01_00210582 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253887 predicted 1150
2 SASI_Hs01_00253888 predicted 1167
3 SASI_Hs01_00253889 predicted 1166
4 SASI_Hs01_00253890 predicted 685
5 SASI_Hs01_00253891 predicted 809
6 SASI_Hs01_00253892 predicted 128
7 SASI_Hs01_00253893 predicted 821
8 SASI_Hs01_00253894 predicted 993
9 SASI_Hs01_00253895 predicted 532
10 SASI_Hs01_00253896 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118196 predicted 699
2 SASI_Rn01_00118198 predicted 569
3 SASI_Rn01_00118199 predicted 283
4 SASI_Rn01_00118200 predicted 325
5 SASI_Rn01_00118201 predicted 427
6 SASI_Rn01_00118202 predicted 660
7 SASI_Rn01_00118203 predicted 486
8 SASI_Rn01_00118204 predicted 224
9 SASI_Rn01_00118205 predicted 542
10 SASI_Rn02_00269883 predicted 235
11 SASI_Rn01_00118197 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117994 predicted 461
2 SASI_Mm01_00117995 predicted 538
3 SASI_Mm01_00117996 predicted 457
4 SASI_Mm01_00117997 predicted 432
5 SASI_Mm01_00117998 predicted 455
6 SASI_Mm01_00117999 predicted 509
7 SASI_Mm01_00118000 predicted 198
8 SASI_Mm01_00118001 predicted 432
9 SASI_Mm01_00118003 predicted 607
10 SASI_Mm02_00327906 predicted 606
11 SASI_Mm01_00118002 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025291
VALIDATED
SRA1 MISSION shRNA Bacterial Glycerol Stock
steroid receptor RNA activator 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025291.1-703s1c1
Sequence:CCGGCAGACTCACTTCACCTGACTTCTCGAGAAGTCAGGTGAAGTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025291.1-467s1c1
Sequence:CCGGGCACTGCTAGTGCAAGAACTTCTCGAGAAGTTCTTGCACTAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025291.1-363s1c1
Sequence:CCGGGTCACACAAAGAAACAGGTATCTCGAGATACCTGTTTCTTTGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025291.2-465s21c1
Sequence:CCGGGCACTGCTAGTGCAAGAACTTCTCGAGAAGTTCTTGCACTAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025291.2-361s21c2
Sequence:CCGGGTCACACAAAGAAACAGGTATCTCGAGATACCTGTTTCTTTGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025291.2-667s21c1
Sequence:CCGGGCTTCCAACAGCCATCATAATCTCGAGATTATGATGGCTGTTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025291.2-426s21c1
Sequence:CCGGGCTGGAGGGAAGTTGTCAATACTCGAGTATTGACAACTTCCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025291.2-701s21c2
Sequence:CCGGCAGACTCACTTCACCTGACTTCTCGAGAAGTCAGGTGAAGTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025291
VALIDATED
SRA1 MISSION shRNA shRNA Plasmid DNA
steroid receptor RNA activator 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025291.1-703s1c1
Sequence:CCGGCAGACTCACTTCACCTGACTTCTCGAGAAGTCAGGTGAAGTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025291.1-467s1c1
Sequence:CCGGGCACTGCTAGTGCAAGAACTTCTCGAGAAGTTCTTGCACTAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025291.1-363s1c1
Sequence:CCGGGTCACACAAAGAAACAGGTATCTCGAGATACCTGTTTCTTTGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025291.2-465s21c1
Sequence:CCGGGCACTGCTAGTGCAAGAACTTCTCGAGAAGTTCTTGCACTAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025291.2-361s21c2
Sequence:CCGGGTCACACAAAGAAACAGGTATCTCGAGATACCTGTTTCTTTGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025291.2-667s21c1
Sequence:CCGGGCTTCCAACAGCCATCATAATCTCGAGATTATGATGGCTGTTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025291.2-426s21c1
Sequence:CCGGGCTGGAGGGAAGTTGTCAATACTCGAGTATTGACAACTTCCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025291.2-701s21c2
Sequence:CCGGCAGACTCACTTCACCTGACTTCTCGAGAAGTCAGGTGAAGTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025291
VALIDATED
SRA1 MISSION shRNA Lentiviral Transduction Particles
steroid receptor RNA activator 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025291.1-703s1c1
Sequence:CCGGCAGACTCACTTCACCTGACTTCTCGAGAAGTCAGGTGAAGTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025291.1-467s1c1
Sequence:CCGGGCACTGCTAGTGCAAGAACTTCTCGAGAAGTTCTTGCACTAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025291.1-363s1c1
Sequence:CCGGGTCACACAAAGAAACAGGTATCTCGAGATACCTGTTTCTTTGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025291.2-465s21c1
Sequence:CCGGGCACTGCTAGTGCAAGAACTTCTCGAGAAGTTCTTGCACTAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025291.2-361s21c2
Sequence:CCGGGTCACACAAAGAAACAGGTATCTCGAGATACCTGTTTCTTTGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025291.2-667s21c1
Sequence:CCGGGCTTCCAACAGCCATCATAATCTCGAGATTATGATGGCTGTTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025291.2-426s21c1
Sequence:CCGGGCTGGAGGGAAGTTGTCAATACTCGAGTATTGACAACTTCCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025291.2-701s21c2
Sequence:CCGGCAGACTCACTTCACCTGACTTCTCGAGAAGTCAGGTGAAGTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001035235
VALIDATED
SRA1 MISSION shRNA Bacterial Glycerol Stock
steroid receptor RNA activator 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001035235.1-1186s1c1
Sequence:CCGGCAGTGGATGGTAGGAGTTAAACTCGAGTTTAACTCCTACCATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035235.2-835s21c1
Sequence:CCGGCCTCCACCTCCTTCAAGTAAGCTCGAGCTTACTTGAAGGAGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035235.2-1051s21c1
Sequence:CCGGGCTGGAGGAAAGTTGTCAATACTCGAGTATTGACAACTTTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035235.2-1182s21c1
Sequence:CCGGTCAGTGGATGGTAGGAGTTAACTCGAGTTAACTCCTACCATCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035235.2-1460s21c1
Sequence:CCGGGAGTTCATGTGTTACTCATAACTCGAGTTATGAGTAACACATGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035235.2-1297s21c1
Sequence:CCGGGGCTTCCAGCAGGCTTCATAACTCGAGTTATGAAGCCTGCTGGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001035235
VALIDATED
SRA1 MISSION shRNA shRNA Plasmid DNA
steroid receptor RNA activator 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001035235.1-1186s1c1
Sequence:CCGGCAGTGGATGGTAGGAGTTAAACTCGAGTTTAACTCCTACCATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035235.2-835s21c1
Sequence:CCGGCCTCCACCTCCTTCAAGTAAGCTCGAGCTTACTTGAAGGAGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035235.2-1051s21c1
Sequence:CCGGGCTGGAGGAAAGTTGTCAATACTCGAGTATTGACAACTTTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035235.2-1182s21c1
Sequence:CCGGTCAGTGGATGGTAGGAGTTAACTCGAGTTAACTCCTACCATCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035235.2-1460s21c1
Sequence:CCGGGAGTTCATGTGTTACTCATAACTCGAGTTATGAGTAACACATGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035235.2-1297s21c1
Sequence:CCGGGGCTTCCAGCAGGCTTCATAACTCGAGTTATGAAGCCTGCTGGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001035235
VALIDATED
SRA1 MISSION shRNA Lentiviral Transduction Particles
steroid receptor RNA activator 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001035235.1-1186s1c1
Sequence:CCGGCAGTGGATGGTAGGAGTTAAACTCGAGTTTAACTCCTACCATCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035235.2-835s21c1
Sequence:CCGGCCTCCACCTCCTTCAAGTAAGCTCGAGCTTACTTGAAGGAGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035235.2-1051s21c1
Sequence:CCGGGCTGGAGGAAAGTTGTCAATACTCGAGTATTGACAACTTTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035235.2-1182s21c1
Sequence:CCGGTCAGTGGATGGTAGGAGTTAACTCGAGTTAACTCCTACCATCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001035235.2-1460s21c1
Sequence:CCGGGAGTTCATGTGTTACTCATAACTCGAGTTATGAGTAACACATGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035235.2-1297s21c1
Sequence:CCGGGGCTTCCAGCAGGCTTCATAACTCGAGTTATGAAGCCTGCTGGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks