EMAIL THIS PAGE TO A FRIEND

SRBD1

S1 RNA binding domain 1

UniProtKB ID: Q8N5C6, Q53T56, Q96TA4, Q9NW11
Gene ID:
Mouse(78586) S1 RNA binding domain 1
Rat(301665) S1 RNA binding domain 1
Zebrafish(100320270) S1 RNA binding domain 1
chicken(421408) S1 RNA binding domain 1
dog(611842) S1 RNA binding domain 1
Horse(100068692) S1 RNA binding domain 1
domestic cat(101094839) S1 RNA binding domain 1
domestic guinea pig(100721537) S1 RNA binding domain 1
naked mole-rat(101700481) S1 RNA binding domain 1
cow(513877) S1 RNA binding domain 1
sheep(101110578) S1 RNA binding domain 1
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018079 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001479682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001479682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001479682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018079 Rosetta Predictions human pricing
XM_001059624 Rosetta Predictions rat pricing
XM_237474 Rosetta Predictions rat pricing
NM_030133 Rosetta Predictions mouse pricing
XM_001479682 Rosetta Predictions mouse pricing
XM_001480810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351231 predicted 1376
2 SASI_Hs01_00032990 predicted 1689
3 SASI_Hs01_00032992 predicted 734
4 SASI_Hs01_00032993 predicted 2447
5 SASI_Hs01_00032994 predicted 1905
6 SASI_Hs01_00032995 predicted 561
7 SASI_Hs01_00032996 predicted 2886
8 SASI_Hs01_00032998 predicted 2082
9 SASI_Hs02_00351232 predicted 2676
10 SASI_Hs02_00351233 predicted 1397
11 SASI_Hs01_00032989 predicted 2355
12 SASI_Hs01_00032991 predicted 1922
13 SASI_Hs01_00032997 predicted 2075
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293765 predicted 2895
2 SASI_Rn02_00293766 predicted 1577
3 SASI_Rn02_00293767 predicted 2643
4 SASI_Rn02_00293768 predicted 615
5 SASI_Rn02_00293769 predicted 2808
6 SASI_Rn02_00293770 predicted 1240
7 SASI_Rn02_00293771 predicted 1773
8 SASI_Rn02_00293772 predicted 960
9 SASI_Rn02_00293773 predicted 795
10 SASI_Rn02_00293774 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390937 predicted 3154
2 SASI_Rn02_00390938 predicted 1838
3 SASI_Rn02_00390939 predicted 2899
4 SASI_Rn02_00390940 predicted 871
5 SASI_Rn02_00390941 predicted 3063
6 SASI_Rn02_00390942 predicted 1492
7 SASI_Rn02_00390943 predicted 2037
8 SASI_Rn02_00390944 predicted 1220
9 SASI_Rn02_00390945 predicted 1058
10 SASI_Rn02_00390946 predicted 1630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173865 predicted 719
2 SASI_Mm01_00173866 predicted 450
3 SASI_Mm01_00173867 predicted 200
4 SASI_Mm01_00173868 predicted 367
5 SASI_Mm01_00173869 predicted 722
6 SASI_Mm01_00173870 predicted 593
7 SASI_Mm01_00173871 predicted 238
8 SASI_Mm01_00173872 predicted 293
9 SASI_Mm01_00173873 predicted 1257
10 SASI_Mm01_00173874 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00411855 predicted 1045
2 SASI_Mm02_00411856 predicted 2083
3 SASI_Mm02_00411857 predicted 2242
4 SASI_Mm02_00411858 predicted 2595
5 SASI_Mm02_00411859 predicted 2724
6 SASI_Mm02_00411860 predicted 821
7 SASI_Mm02_00411861 predicted 1991
8 SASI_Mm02_00411862 predicted 2463
9 SASI_Mm02_00411863 predicted 1882
10 SASI_Mm02_00411864 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00419989 predicted 2323
2 SASI_Mm02_00419990 predicted 1649
3 SASI_Mm02_00419991 predicted 2991
4 SASI_Mm02_00419992 predicted 2082
5 SASI_Mm02_00419993 predicted 2249
6 SASI_Mm02_00419994 predicted 1768
7 SASI_Mm02_00419995 predicted 1987
8 SASI_Mm02_00419996 predicted 1545
9 SASI_Mm02_00419997 predicted 2185
10 SASI_Mm02_00419998 predicted 1756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018079
VALIDATED
SRBD1 MISSION shRNA Bacterial Glycerol Stock
S1 RNA binding domain 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018079.4-802s21c1
Sequence:CCGGTCCCTTCATTATACGTTATAGCTCGAGCTATAACGTATAATGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018079.4-764s21c1
Sequence:CCGGGCCAACATCATTCGTCTCTTTCTCGAGAAAGAGACGAATGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018079.4-1549s21c1
Sequence:CCGGTTCCTTTAAACGCCTTATTTACTCGAGTAAATAAGGCGTTTAAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018079.4-2188s21c1
Sequence:CCGGCTTTGTGGGAGTGGATATTAACTCGAGTTAATATCCACTCCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018079.3-734s1c1
Sequence:CCGGGCCAACATCATTCGTCTCTTTCTCGAGAAAGAGACGAATGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018079.3-1481s1c1
Sequence:CCGGCCAGAGTTAATGAAGATCTTACTCGAGTAAGATCTTCATTAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018079.3-1960s1c1
Sequence:CCGGCCCTGAAGCTAACAAAGAGATCTCGAGATCTCTTTGTTAGCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018079.3-2885s1c1
Sequence:CCGGCCCATACGAAATGTAACAGAACTCGAGTTCTGTTACATTTCGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018079.3-2432s1c1
Sequence:CCGGGCAGACGTTGAGGTCACAAATCTCGAGATTTGTGACCTCAACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018079
VALIDATED
SRBD1 MISSION shRNA shRNA Plasmid DNA
S1 RNA binding domain 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018079.4-802s21c1
Sequence:CCGGTCCCTTCATTATACGTTATAGCTCGAGCTATAACGTATAATGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018079.4-764s21c1
Sequence:CCGGGCCAACATCATTCGTCTCTTTCTCGAGAAAGAGACGAATGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018079.4-1549s21c1
Sequence:CCGGTTCCTTTAAACGCCTTATTTACTCGAGTAAATAAGGCGTTTAAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018079.4-2188s21c1
Sequence:CCGGCTTTGTGGGAGTGGATATTAACTCGAGTTAATATCCACTCCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018079.3-734s1c1
Sequence:CCGGGCCAACATCATTCGTCTCTTTCTCGAGAAAGAGACGAATGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018079.3-1481s1c1
Sequence:CCGGCCAGAGTTAATGAAGATCTTACTCGAGTAAGATCTTCATTAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018079.3-1960s1c1
Sequence:CCGGCCCTGAAGCTAACAAAGAGATCTCGAGATCTCTTTGTTAGCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018079.3-2885s1c1
Sequence:CCGGCCCATACGAAATGTAACAGAACTCGAGTTCTGTTACATTTCGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018079.3-2432s1c1
Sequence:CCGGGCAGACGTTGAGGTCACAAATCTCGAGATTTGTGACCTCAACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018079
VALIDATED
SRBD1 MISSION shRNA Lentiviral Transduction Particles
S1 RNA binding domain 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018079.4-802s21c1
Sequence:CCGGTCCCTTCATTATACGTTATAGCTCGAGCTATAACGTATAATGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018079.4-764s21c1
Sequence:CCGGGCCAACATCATTCGTCTCTTTCTCGAGAAAGAGACGAATGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018079.4-1549s21c1
Sequence:CCGGTTCCTTTAAACGCCTTATTTACTCGAGTAAATAAGGCGTTTAAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018079.4-2188s21c1
Sequence:CCGGCTTTGTGGGAGTGGATATTAACTCGAGTTAATATCCACTCCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018079.3-734s1c1
Sequence:CCGGGCCAACATCATTCGTCTCTTTCTCGAGAAAGAGACGAATGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018079.3-1481s1c1
Sequence:CCGGCCAGAGTTAATGAAGATCTTACTCGAGTAAGATCTTCATTAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018079.3-1960s1c1
Sequence:CCGGCCCTGAAGCTAACAAAGAGATCTCGAGATCTCTTTGTTAGCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018079.3-2885s1c1
Sequence:CCGGCCCATACGAAATGTAACAGAACTCGAGTTCTGTTACATTTCGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018079.3-2432s1c1
Sequence:CCGGGCAGACGTTGAGGTCACAAATCTCGAGATTTGTGACCTCAACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001479682
SRBD1 MISSION shRNA Bacterial Glycerol Stock
S1 RNA binding domain 1
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000217868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001479682.1-1149s1c1
Sequence:CCGGGCATGTGTCTGCTCCATATAACTCGAGTTATATGGAGCAGACACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001479682.1-3072s1c1
Sequence:CCGGGATTCCTATCCGGTTCATAACCTCGAGGTTATGAACCGGATAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001479682.1-1002s1c1
Sequence:CCGGCTTAAGAGAAGTTCGTCAAACCTCGAGGTTTGACGAACTTCTCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001479682
SRBD1 MISSION shRNA shRNA Plasmid DNA
S1 RNA binding domain 1
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000217868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001479682.1-1149s1c1
Sequence:CCGGGCATGTGTCTGCTCCATATAACTCGAGTTATATGGAGCAGACACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001479682.1-3072s1c1
Sequence:CCGGGATTCCTATCCGGTTCATAACCTCGAGGTTATGAACCGGATAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001479682.1-1002s1c1
Sequence:CCGGCTTAAGAGAAGTTCGTCAAACCTCGAGGTTTGACGAACTTCTCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001479682
SRBD1 MISSION shRNA Lentiviral Transduction Particles
S1 RNA binding domain 1
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000217868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001479682.1-1149s1c1
Sequence:CCGGGCATGTGTCTGCTCCATATAACTCGAGTTATATGGAGCAGACACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001479682.1-3072s1c1
Sequence:CCGGGATTCCTATCCGGTTCATAACCTCGAGGTTATGAACCGGATAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001479682.1-1002s1c1
Sequence:CCGGCTTAAGAGAAGTTCGTCAAACCTCGAGGTTTGACGAACTTCTCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030133
VALIDATED
SRBD1 MISSION shRNA Bacterial Glycerol Stock
S1 RNA binding domain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030133.1-1281s1c1
Sequence:CCGGGCCACTTTATTGAGGTGTTATCTCGAGATAACACCTCAATAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030133.1-220s1c1
Sequence:CCGGGAACAGTTGAAGAAGGTGAAACTCGAGTTTCACCTTCTTCAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030133.1-441s1c1
Sequence:CCGGCCATCCGGAATCCTATGACATCTCGAGATGTCATAGGATTCCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030133.1-1125s1c1
Sequence:CCGGGCAGTTTCTGTCTTTGTAATTCTCGAGAATTACAAAGACAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030133.1-1282s1c1
Sequence:CCGGCCACTTTATTGAGGTGTTATTCTCGAGAATAACACCTCAATAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030133
VALIDATED
SRBD1 MISSION shRNA shRNA Plasmid DNA
S1 RNA binding domain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030133.1-1281s1c1
Sequence:CCGGGCCACTTTATTGAGGTGTTATCTCGAGATAACACCTCAATAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030133.1-220s1c1
Sequence:CCGGGAACAGTTGAAGAAGGTGAAACTCGAGTTTCACCTTCTTCAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030133.1-441s1c1
Sequence:CCGGCCATCCGGAATCCTATGACATCTCGAGATGTCATAGGATTCCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030133.1-1125s1c1
Sequence:CCGGGCAGTTTCTGTCTTTGTAATTCTCGAGAATTACAAAGACAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030133.1-1282s1c1
Sequence:CCGGCCACTTTATTGAGGTGTTATTCTCGAGAATAACACCTCAATAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030133
VALIDATED
SRBD1 MISSION shRNA Lentiviral Transduction Particles
S1 RNA binding domain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030133.1-1281s1c1
Sequence:CCGGGCCACTTTATTGAGGTGTTATCTCGAGATAACACCTCAATAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030133.1-220s1c1
Sequence:CCGGGAACAGTTGAAGAAGGTGAAACTCGAGTTTCACCTTCTTCAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030133.1-441s1c1
Sequence:CCGGCCATCCGGAATCCTATGACATCTCGAGATGTCATAGGATTCCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030133.1-1125s1c1
Sequence:CCGGGCAGTTTCTGTCTTTGTAATTCTCGAGAATTACAAAGACAGAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030133.1-1282s1c1
Sequence:CCGGCCACTTTATTGAGGTGTTATTCTCGAGAATAACACCTCAATAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks