EMAIL THIS PAGE TO A FRIEND

SRC

v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog

Synonyms: ASV SRC1 c-SRC p60-Src
UniProtKB ID: P12931, E1P5V4, Q76P87, Q86VB9, Q9H5A8
Gene ID:
Human(6714) Summary: This gene is highly similar to the v-src gene of Rous sarcoma virus. This proto-oncogene may play a role in the regulation of embryonic development and cell growth. The protein encoded by this gene is a tyrosine-protein kinase whose activity can be inhibited by phosphorylation by c-SRC kinase. Mutations in this gene could be involved in the malignant progression of colon cancer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20779) Rous sarcoma oncogene
Rat(83805) v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
cow(535742) v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)
sheep(101103084) v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)
naked mole-rat(101703827) v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)
domestic guinea pig(100728509) Rous sarcoma oncogene
Zebrafish(325084) v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)
domestic cat(101100378) v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)
dog(485864) v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)
chicken(396442) v-src sarcoma viral oncogene
245 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504644 Anti-phospho-Src (pSer75) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4301442 Anti-phospho-Src (pSer75) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4504669 Anti-phospho-Src (pTyr216) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
S1940 Anti-phospho-Src (pTyr418) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution chicken, human, mouse, rat
western blot pricing
SAB4504536 Anti-phospho-Src (pTyr418) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
S2065 Anti-phospho-Src (pTyr529) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse, chicken
immunohistochemistry, western blot pricing
SAB4504537 Anti-phospho-Src (pTyr529) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300126 Anti-phospho-SRC (pTyr529) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300433 Anti-SRC (Ab-529) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB2102295 Anti-SRC antibody produced in rabbit affinity isolated antibody canine, rat, guinea pig, bovine, human, mouse, rabbit
western blot pricing
HPA030875 Anti-SRC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502847 Anti-SRC antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB2103351 Anti-SRC, (N-terminal) antibody produced in rabbit affinity isolated antibody canine, bovine, mouse, rat, human, guinea pig, rabbit
western blot pricing
SAB4502844 Anti-SRC, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4502845 Anti-SRC, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4502846 Anti-SRC, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
WH0006714M1 Monoclonal Anti-SRC antibody produced in mouse clone 1B9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300366 Monoclonal Anti-SRC antibody produced in mouse clone 5D10C4, ascites fluid human
ELISA, western blot pricing
SAB5300367 Monoclonal Anti-SRC antibody produced in mouse clone 1F11, ascites fluid human
ELISA, flow cytometry, immunohistochemistry, western blot pricing
S1686 Monoclonal Anti-v-Src antibody produced in mouse clone 327, purified immunoglobulin, lyophilized powder mouse, human, rat
immunoprecipitation, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
38730 Citrate standard for IC 1000 mg/L, analytical standard human pricing
C2404 Citric acid anhydrous, cell culture tested, plant cell culture tested human pricing
251275 Citric acid ACS reagent, ≥99.5% human pricing
C83155 Citric acid 99% human pricing
46933 Citric acid analytical standard human pricing
27487 Citric acid BioUltra, anhydrous, ≥99.5% (T) human pricing
27109 Citric acid meets analytical specification of Ph. Eur., BP, USP, E330, anhydrous, 99.5-100.5% (based on anhydrous substance) human pricing
W230618 Citric acid ≥99.5%, FCC, FG human pricing
M1296 Malonic acid ReagentPlus®, 99% human pricing
46938-U Malonic acid analytical standard human pricing
04621 Oxalate standard for IC 1.000 g/L in H2O, analytical standard human pricing
75688 Oxalic acid puriss. p.a., anhydrous, ≥99.0% (RT) human pricing
658537 Oxalic acid purified grade, 99.999% trace metals basis human pricing
241172 Oxalic acid ReagentPlus®, ≥99% human pricing
194131 Oxalic acid 98% human pricing
68487 Oxalic acid concentrate 0.1 M (COOH)2 (0.2N), eluent concentrate for IC human pricing
160369 Phenylmalonic acid 98% human pricing
03366 Phosphate atomic spectroscopy standard concentrate 1.00 g PO43- 1.00 g/L, for 1L standard solution, analytical standard human pricing
03367 Phosphate atomic spectroscopy standard concentrate 10.00 g PO43- 10.00 g/L, for 1 l standard solution, analytical standard human pricing
P5811 Phosphoric acid BioReagent, suitable for insect cell culture, 85% human pricing
466123 Phosphoric acid crystalline, ≥99.999% trace metals basis human pricing
452289 Phosphoric acid ≥85 wt. % in H2O, ≥99.999% trace metals basis Green Alternative human pricing
345245 Phosphoric acid 85 wt. % in H2O, 99.99% trace metals basis Green Alternative human pricing
79617 Phosphoric acid BioUltra, ≥85% (T) human pricing
438081 Phosphoric acid ACS reagent, ≥85 wt. % in H2O Green Alternative human pricing
215104 Phosphoric acid ACS reagent, ≥85 wt. % in H2O Green Alternative human pricing
79621 Phosphoric acid puriss. p.a., ACS reagent, packed in coated, shock- and leak-protected glass bottle, ≥85% (T) human pricing
30417 Phosphoric acid puriss. p.a., ACS reagent, reag. ISO, reag. Ph. Eur., ≥85% human pricing
04102 Phosphoric acid puriss., ≥99% human pricing
04107 Phosphoric acid puriss., meets analytical specification of Ph. Eur., BP, NF, FCC, 85.0-88.0% human pricing
40299 Phosphoric acid semiconductor grade VLSI PURANAL (Honeywell 17644) human pricing
40278 Phosphoric acid semiconductor grade MOS PURANAL (Honeywell 17938), ≥85% human pricing
40266 Phosphoric acid semiconductor grade PURANAL (Honeywell 17861), ≥85% human pricing
695017 Phosphoric acid ACS reagent, ≥85 wt. % in H2O human pricing
W290017 Phosphoric acid solution 85 wt. % in H2O, FCC, FG human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0425 AQUA Peptide GSLLDFL[K] human, mouse, rat pricing
AQ0427 AQUA Peptide LIEDNEYTA[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009271 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009271 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009271 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU071351 MISSION® esiRNA esiRNA targeting mouse Src (esiRNA1) mouse pricing

Related Products

Product # Description Species Add to Cart
 
05-185 Anti-avian Src Antibody, clone EC10 200 µg, Anti-avian Src Antibody, clone EC10 detects level of avian Src & has been published & validated for use in IP, WB & IC. pricing
07-791 Anti-phospho-Src Antibody (Tyr215) 100 µL, Anti-Src (Tyr215) Antibody is an antibody against Src (Tyr215) for use in ELISA & WB. pricing
04-857 Anti-phospho-Src family (Tyr416) Antibody, clone 2N8, rabbit monoclonal 100 µL, Anti-phospho-Src family (Tyr416) Antibody, clone 2N8 is an antibody against phospho-Src family (Tyr416) for use in WB. pricing
05-857 Anti-phospho-Src family (Tyr416) Antibody, clone 2N8, rabbit monoclonal 100 µL, This Anti-phospho-Src family (Tyr416) Antibody, clone 2N8 is validated for use in WB for the detection of phospho-Src family (Tyr416). pricing
05-677 Anti-phospho-Src (Tyr416) Antibody, clone 9A6 100 µg, Detect phospho-Src (Tyr416) using this Anti-phospho-Src (Tyr416) Antibody, clone 9A6 validated for use in WB & IP. pricing
07-909 Anti-phospho-Src (Tyr418) Antibody 100 µL, Anti-phospho-Src (Tyr418) Antibody detects level of phospho-Src (Tyr418) & has been published & validated for use in IC, IH & WB. pricing
ABC105 Anti-Phospho-Src (Tyr419) Antibody 50 µg, Detect Phospho-Src (Tyr419) using this Anti-Phospho-Src (Tyr419) Antibody validated for use in Western Blotting, Peptide Inhibition Assay. pricing
05-184 Anti-Src Antibody, clone GD11 200 µg, Anti-Src Antibody, clone GD11 detects level of Src & has been published & validated for use in IP & WB. pricing
16-186 Anti-Src Antibody, clone GD11, agarose 200 µg, Anti-Src Antibody, clone GD11, agarose is an antibody against Src for use in IP. pricing
05-184-AF488 Anti-Src Antibody, clone GD11, Alexa Fluor® 488 conjugate 100 µL, Anti-Src Antibody, clone GD11, Alexa Fluor® 488 conjugate is an antibody against Src for use in Immunocytochemistry. pricing
04-772 Anti-Src Antibody, CT, clone NL19 | 04-772 100 µL pricing
MABT512 Anti-Src, clone EPR5496, Rabbit Monoclonal Antibody 100 µL, This Anti-Src, clone EPR5496, Rabbit Monoclonal Antibody is validated for use in Western Blotting and Immunohistochemistry and Immunofluorescence and Flow Cytometry for the detection of Src. pricing
MABS193 Anti-v-Src Antibody, clone 327 100 µg, Anti-v-Src Antibody, clone 327 detects level of v-Src & has been published & validated for use in Western Blotting. pricing
FCMAB253F Milli-Mark™Anti-Src-FITC Antibody, clone GD11 100 tests, Milli-MarkAnti-Src-FITC Antibody, clone GD11 detects level of Src & has been published & validated for use in FC. pricing
14-746-M Src (1-530) Protein, active, 10 µg 10 µg, Active, N-terminal 6His-tagged, recombinant, human Src, amino acids 1-530, expressed by baculovirus in Sf21 insect cells. For use in Kinase Assays. pricing
14-746M-M Src (1-530) Protein, active, 250 µg 250 µg, Active, N-terminal 6His-tagged, recombinant, human Src, amino acids 1-530, expressed by baculovirus in Sf21 insect cells. For use in Kinase Assays. pricing
17-131 Src Assay Kit 1 kit, The radioactive Src Assay Kit is designed to measure the phosphotransferase activity of Src kinase in immunoprecipitates & column fractions. pricing
20-121 Src Kinase Reaction Buffer 1 mL pricing
20-110 Src Manganese/ATP Cocktail 1 mL pricing
14-326-M Src Protein, active, 10 µg 10 µg, Active, N-Terminal His6-tagged, recombinant, full-length, human Src. For use in Kinase Assays. pricing
12-140 Src Substrate Peptide 1 mg, Src Substrate Peptide primarily used in Kinase Assays. pricing
14-748-M Src (T341M) Protein, active, 10 µg 10 µg, Active, N-terminal 6His-tagged, recombinant, full-length human Src, containing the T341M mutation. For use in Kinase Assays. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005417 siRNAs that have been validated in the lab human pricing
NM_198291 Rosetta Predictions human pricing
NM_031977 Rosetta Predictions rat pricing
NM_001025395 Rosetta Predictions mouse pricing
NM_009271 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005417 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112907 validated 1421
1 SASI_Hs01_00112905 validated 2234
2 SASI_Hs01_00112904 predicted 704
3 SASI_Hs01_00112909 predicted 935
4 SASI_Hs01_00112910 predicted 627
5 SASI_Hs02_00339554 predicted 1556
6 SASI_Hs02_00339555 predicted 2395
7 SASI_Hs01_00112912 predicted 967
8 SASI_Hs01_00112913 predicted 1577
9 SASI_Hs02_00339556 predicted 1335
10 SASI_Hs01_00112906 predicted 711
11 SASI_Hs01_00112908 predicted 640
12 SASI_Hs01_00112911 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115729 predicted 604
2 SASI_Hs01_00115730 predicted 2126
3 SASI_Hs01_00115732 predicted 1326
4 SASI_Hs01_00115734 predicted 835
5 SASI_Hs01_00115735 predicted 524
6 SASI_Hs02_00371859 predicted 1453
7 SASI_Hs02_00371860 predicted 2294
8 SASI_Hs01_00115737 predicted 863
9 SASI_Hs01_00115738 predicted 1473
10 SASI_Hs02_00371861 predicted 1239
11 SASI_Hs01_00115731 predicted 604
12 SASI_Hs01_00115733 predicted 545
13 SASI_Hs01_00115736 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102343 predicted 692
2 SASI_Rn02_00265373 predicted 1487
3 SASI_Rn01_00102345 predicted 297
4 SASI_Rn01_00102346 predicted 530
5 SASI_Rn01_00102347 predicted 1146
6 SASI_Rn01_00102349 predicted 1409
7 SASI_Rn01_00102350 predicted 1379
8 SASI_Rn01_00102351 predicted 591
9 SASI_Rn02_00265374 predicted 327
10 SASI_Rn01_00102352 predicted 1264
11 SASI_Rn01_00102344 predicted 500
12 SASI_Rn01_00102348 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129746 predicted 2471
2 SASI_Mm01_00129747 predicted 2002
3 SASI_Mm01_00129748 predicted 1512
4 SASI_Mm01_00129749 predicted 1536
5 SASI_Mm01_00129750 predicted 1067
6 SASI_Mm01_00129751 predicted 385
7 SASI_Mm01_00129752 predicted 2008
8 SASI_Mm02_00287869 predicted 1095
9 SASI_Mm01_00129753 predicted 1775
10 SASI_Mm01_00129754 predicted 1764
11 SASI_Mm01_00129755 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050749 predicted 2497
2 SASI_Mm01_00050750 predicted 2013
3 SASI_Mm01_00050751 predicted 1531
4 SASI_Mm01_00050752 predicted 1562
5 SASI_Mm01_00050753 predicted 1079
6 SASI_Mm01_00050754 predicted 391
7 SASI_Mm01_00050755 predicted 2026
8 SASI_Mm02_00315760 predicted 1108
9 SASI_Mm01_00050756 predicted 1790
10 SASI_Mm01_00050757 predicted 1788
11 SASI_Mm01_00050758 predicted 1506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198291
VALIDATED
SRC MISSION shRNA Bacterial Glycerol Stock
v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_198291.1-1579s1c1
Sequence:CCGGGCTCGGCTCATTGAAGACAATCTCGAGATTGTCTTCAATGAGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_198291.1-648s1c1
Sequence:CCGGGACAGACCTGTCCTTCAAGAACTCGAGTTCTTGAAGGACAGGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A-431
TRC Version: 1 Clone ID:NM_198291.1-1294s1c1
Sequence:CCGGGTCATGAAGAAGCTGAGGCATCTCGAGATGCCTCAGCTTCTTCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_198291.1-829s1c1
Sequence:CCGGTCAGAGCGGTTACTGCTCAATCTCGAGATTGAGCAGTAACCGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198291.1-3422s1c1
Sequence:CCGGGCTGACAGTTTGTGGCATCTTCTCGAGAAGATGCCACAAACTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198291.1-1711s1c1
Sequence:CCGGCTGACTGAGCTCACCACAAAGCTCGAGCTTTGTGGTGAGCTCAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198291.1-2718s1c1
Sequence:CCGGCATCCTCAGGAACCAACAATTCTCGAGAATTGTTGGTTCCTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196395    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198291.1-3496s1c1
Sequence:CCGGGCGTCCATATTTAACATGTAACTCGAGTTACATGTTAAATATGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198291.1-675s21c1
Sequence:CCGGGCGGCTCCAGATTGTCAACAACTCGAGTTGTTGACAATCTGGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198291.1-2718s21c1
Sequence:CCGGCATCCTCAGGAACCAACAATTCTCGAGAATTGTTGGTTCCTGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198291.1-1579s21c1
Sequence:CCGGGCTCGGCTCATTGAAGACAATCTCGAGATTGTCTTCAATGAGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198291.1-648s21c1
Sequence:CCGGGACAGACCTGTCCTTCAAGAACTCGAGTTCTTGAAGGACAGGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198291
VALIDATED
SRC MISSION shRNA shRNA Plasmid DNA
v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_198291.1-1579s1c1
Sequence:CCGGGCTCGGCTCATTGAAGACAATCTCGAGATTGTCTTCAATGAGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_198291.1-648s1c1
Sequence:CCGGGACAGACCTGTCCTTCAAGAACTCGAGTTCTTGAAGGACAGGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A-431
TRC Version: 1 Clone ID:NM_198291.1-1294s1c1
Sequence:CCGGGTCATGAAGAAGCTGAGGCATCTCGAGATGCCTCAGCTTCTTCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_198291.1-829s1c1
Sequence:CCGGTCAGAGCGGTTACTGCTCAATCTCGAGATTGAGCAGTAACCGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198291.1-3422s1c1
Sequence:CCGGGCTGACAGTTTGTGGCATCTTCTCGAGAAGATGCCACAAACTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198291.1-1711s1c1
Sequence:CCGGCTGACTGAGCTCACCACAAAGCTCGAGCTTTGTGGTGAGCTCAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198291.1-2718s1c1
Sequence:CCGGCATCCTCAGGAACCAACAATTCTCGAGAATTGTTGGTTCCTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196395    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198291.1-3496s1c1
Sequence:CCGGGCGTCCATATTTAACATGTAACTCGAGTTACATGTTAAATATGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198291.1-675s21c1
Sequence:CCGGGCGGCTCCAGATTGTCAACAACTCGAGTTGTTGACAATCTGGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198291.1-2718s21c1
Sequence:CCGGCATCCTCAGGAACCAACAATTCTCGAGAATTGTTGGTTCCTGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198291.1-1579s21c1
Sequence:CCGGGCTCGGCTCATTGAAGACAATCTCGAGATTGTCTTCAATGAGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198291.1-648s21c1
Sequence:CCGGGACAGACCTGTCCTTCAAGAACTCGAGTTCTTGAAGGACAGGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198291
VALIDATED
SRC MISSION shRNA Lentiviral Transduction Particles
v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_198291.1-1579s1c1
Sequence:CCGGGCTCGGCTCATTGAAGACAATCTCGAGATTGTCTTCAATGAGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_198291.1-648s1c1
Sequence:CCGGGACAGACCTGTCCTTCAAGAACTCGAGTTCTTGAAGGACAGGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A-431
TRC Version: 1 Clone ID:NM_198291.1-1294s1c1
Sequence:CCGGGTCATGAAGAAGCTGAGGCATCTCGAGATGCCTCAGCTTCTTCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_198291.1-829s1c1
Sequence:CCGGTCAGAGCGGTTACTGCTCAATCTCGAGATTGAGCAGTAACCGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198291.1-3422s1c1
Sequence:CCGGGCTGACAGTTTGTGGCATCTTCTCGAGAAGATGCCACAAACTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198291.1-1711s1c1
Sequence:CCGGCTGACTGAGCTCACCACAAAGCTCGAGCTTTGTGGTGAGCTCAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198291.1-2718s1c1
Sequence:CCGGCATCCTCAGGAACCAACAATTCTCGAGAATTGTTGGTTCCTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196395    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198291.1-3496s1c1
Sequence:CCGGGCGTCCATATTTAACATGTAACTCGAGTTACATGTTAAATATGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198291.1-675s21c1
Sequence:CCGGGCGGCTCCAGATTGTCAACAACTCGAGTTGTTGACAATCTGGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198291.1-2718s21c1
Sequence:CCGGCATCCTCAGGAACCAACAATTCTCGAGAATTGTTGGTTCCTGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198291.1-1579s21c1
Sequence:CCGGGCTCGGCTCATTGAAGACAATCTCGAGATTGTCTTCAATGAGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198291.1-648s21c1
Sequence:CCGGGACAGACCTGTCCTTCAAGAACTCGAGTTCTTGAAGGACAGGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009271
VALIDATED
SRC MISSION shRNA Bacterial Glycerol Stock
v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-476s1c1
Sequence:CCGGGCAAGATCACTAGACGGGAATCTCGAGATTCCCGTCTAGTGATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-703s1c1
Sequence:CCGGGTGGCTTACTACTCCAAACATCTCGAGATGTTTGGAGTAGTAAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-1186s1c1
Sequence:CCGGCGAGCCGCCAATATCCTAGTACTCGAGTACTAGGATATTGGCGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-324s1c1
Sequence:CCGGGCGGCTGCAGATTGTCAATAACTCGAGTTATTGACAATCTGCAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-612s1c1
Sequence:CCGGCCTAAATGTGAAACACTACAACTCGAGTTGTAGTGTTTCACATTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009271.3-1087s21c1
Sequence:CCGGGTGGCTTACTACTCCAAACATCTCGAGATGTTTGGAGTAGTAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009271.3-860s21c1
Sequence:CCGGGCAAGATCACTAGACGGGAATCTCGAGATTCCCGTCTAGTGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009271.3-1570s21c1
Sequence:CCGGCGAGCCGCCAATATCCTAGTACTCGAGTACTAGGATATTGGCGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009271.3-996s21c1
Sequence:CCGGCCTAAATGTGAAACACTACAACTCGAGTTGTAGTGTTTCACATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009271.3-708s21c1
Sequence:CCGGGCGGCTGCAGATTGTCAATAACTCGAGTTATTGACAATCTGCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009271
VALIDATED
SRC MISSION shRNA shRNA Plasmid DNA
v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-476s1c1
Sequence:CCGGGCAAGATCACTAGACGGGAATCTCGAGATTCCCGTCTAGTGATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-703s1c1
Sequence:CCGGGTGGCTTACTACTCCAAACATCTCGAGATGTTTGGAGTAGTAAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-1186s1c1
Sequence:CCGGCGAGCCGCCAATATCCTAGTACTCGAGTACTAGGATATTGGCGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-324s1c1
Sequence:CCGGGCGGCTGCAGATTGTCAATAACTCGAGTTATTGACAATCTGCAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-612s1c1
Sequence:CCGGCCTAAATGTGAAACACTACAACTCGAGTTGTAGTGTTTCACATTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009271.3-1087s21c1
Sequence:CCGGGTGGCTTACTACTCCAAACATCTCGAGATGTTTGGAGTAGTAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009271.3-860s21c1
Sequence:CCGGGCAAGATCACTAGACGGGAATCTCGAGATTCCCGTCTAGTGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009271.3-1570s21c1
Sequence:CCGGCGAGCCGCCAATATCCTAGTACTCGAGTACTAGGATATTGGCGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009271.3-996s21c1
Sequence:CCGGCCTAAATGTGAAACACTACAACTCGAGTTGTAGTGTTTCACATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009271.3-708s21c1
Sequence:CCGGGCGGCTGCAGATTGTCAATAACTCGAGTTATTGACAATCTGCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009271
VALIDATED
SRC MISSION shRNA Lentiviral Transduction Particles
v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-476s1c1
Sequence:CCGGGCAAGATCACTAGACGGGAATCTCGAGATTCCCGTCTAGTGATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-703s1c1
Sequence:CCGGGTGGCTTACTACTCCAAACATCTCGAGATGTTTGGAGTAGTAAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-1186s1c1
Sequence:CCGGCGAGCCGCCAATATCCTAGTACTCGAGTACTAGGATATTGGCGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-324s1c1
Sequence:CCGGGCGGCTGCAGATTGTCAATAACTCGAGTTATTGACAATCTGCAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009271.1-612s1c1
Sequence:CCGGCCTAAATGTGAAACACTACAACTCGAGTTGTAGTGTTTCACATTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009271.3-1087s21c1
Sequence:CCGGGTGGCTTACTACTCCAAACATCTCGAGATGTTTGGAGTAGTAAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009271.3-860s21c1
Sequence:CCGGGCAAGATCACTAGACGGGAATCTCGAGATTCCCGTCTAGTGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009271.3-1570s21c1
Sequence:CCGGCGAGCCGCCAATATCCTAGTACTCGAGTACTAGGATATTGGCGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009271.3-996s21c1
Sequence:CCGGCCTAAATGTGAAACACTACAACTCGAGTTGTAGTGTTTCACATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009271.3-708s21c1
Sequence:CCGGGCGGCTGCAGATTGTCAATAACTCGAGTTATTGACAATCTGCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks