EMAIL THIS PAGE TO A FRIEND

SRCAP

Snf2-related CREBBP activator protein

Synonyms: DOMO1 EAF1 FLHS SWR1
UniProtKB ID: Q6ZRS2, B0JZA6, O15026, Q7Z744, Q9Y5L9
Gene ID:
Human(10847) Summary: This gene encodes the core catalytic component of the multiprotein chromatin-remodeling SRCAP complex. The encoded protein is an ATPase that is necessary for the incorporation of the histone variant H2A.Z into nucleosomes. It can function as a transcriptional activator in Notch-mediated, CREB-mediated and steroid receptor-mediated transcription. Mutations in this gene cause Floating-Harbor syndrome, a rare disorder characterized by short stature, language deficits and dysmorphic facial features. [provided by RefSeq, Feb 2012]
Mouse(100043597) Snf2-related CREBBP activator protein
Rat(361652) Snf2-related CREBBP activator protein
Zebrafish(563456) Snf2-related CREBBP activator protein
dog(479773) Snf2-related CREBBP activator protein
Horse(100063654) Snf2-related CREBBP activator protein
domestic cat(101084157) Snf2-related CREBBP activator protein
domestic guinea pig(100731238) Snf2-related CREBBP activator protein
naked mole-rat(101699384) Snf2-related CREBBP activator protein
cow(788113) Snf2-related CREBBP activator protein
sheep(101123522) Snf2-related CREBBP activator protein
231 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA028929 Anti-SRCAP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006662 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157301 MISSION® esiRNA esiRNA human SRCAP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006662 Rosetta Predictions human pricing
XM_001080260 Rosetta Predictions rat pricing
XM_341932 Rosetta Predictions rat pricing
XM_001480403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204848 predicted 1141
2 SASI_Hs01_00204849 predicted 6482
3 SASI_Hs01_00204850 predicted 3942
4 SASI_Hs01_00204851 predicted 3023
5 SASI_Hs02_00342046 predicted 787
6 SASI_Hs01_00204852 predicted 5273
7 SASI_Hs01_00204854 predicted 6870
8 SASI_Hs01_00204855 predicted 3197
9 SASI_Hs01_00204856 predicted 2527
10 SASI_Hs02_00342047 predicted 6710
11 SASI_Hs01_00204853 predicted 5324
12 SASI_Hs01_00204857 predicted 4193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367340 predicted 6794
2 SASI_Rn02_00367341 predicted 6759
3 SASI_Rn02_00367342 predicted 8728
4 SASI_Rn02_00367343 predicted 8373
5 SASI_Rn02_00367344 predicted 5501
6 SASI_Rn02_00367345 predicted 8763
7 SASI_Rn02_00367346 predicted 6864
8 SASI_Rn02_00367347 predicted 6188
9 SASI_Rn02_00367348 predicted 3231
10 SASI_Rn02_00367349 predicted 3403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393583 predicted 5859
2 SASI_Rn02_00393584 predicted 5830
3 SASI_Rn02_00393585 predicted 7799
4 SASI_Rn02_00393586 predicted 7440
5 SASI_Rn02_00393587 predicted 4574
6 SASI_Rn02_00393588 predicted 7830
7 SASI_Rn02_00393589 predicted 5938
8 SASI_Rn02_00393590 predicted 5264
9 SASI_Rn02_00393591 predicted 2474
10 SASI_Rn02_00393592 predicted 2638
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00417350 predicted 944
2 SASI_Mm02_00417351 predicted 6946
3 SASI_Mm02_00417352 predicted 8566
4 SASI_Mm02_00417353 predicted 1653
5 SASI_Mm02_00417354 predicted 3534
6 SASI_Mm02_00417355 predicted 10116
7 SASI_Mm02_00417356 predicted 2839
8 SASI_Mm02_00417357 predicted 5632
9 SASI_Mm02_00417358 predicted 7022
10 SASI_Mm02_00417359 predicted 8942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006662
VALIDATED
SRCAP MISSION shRNA Bacterial Glycerol Stock
Snf2-related CREBBP activator protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006662.2-10127s21c1
Sequence:CCGGGACCAGGCCTGACTCTGTTAACTCGAGTTAACAGAGTCAGGCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006662.2-6683s21c1
Sequence:CCGGGCCTTGATGGAACGGTTCAATCTCGAGATTGAACCGTTCCATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006662.2-1504s21c1
Sequence:CCGGCCCTCAGGTGTTGGAGATAAACTCGAGTTTATCTCCAACACCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006662.2-7085s21c1
Sequence:CCGGGCCAGCAAGCAGACTCATATTCTCGAGAATATGAGTCTGCTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006662.2-6499s21c1
Sequence:CCGGCCAGTATGATTGCGGAAAGTTCTCGAGAACTTTCCGCAATCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-2437s1c1
Sequence:CCGGCGGATAGACATGGGTCGATTTCTCGAGAAATCGACCCATGTCTATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-5547s1c1
Sequence:CCGGCCAGTATGATTGCGGAAAGTTCTCGAGAACTTTCCGCAATCATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-6133s1c1
Sequence:CCGGGCCAGCAAGCAGACTCATATTCTCGAGAATATGAGTCTGCTTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-5731s1c1
Sequence:CCGGGCCTTGATGGAACGGTTCAATCTCGAGATTGAACCGTTCCATCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-738s1c1
Sequence:CCGGCCCTCAGGTGTTGGAGATAAACTCGAGTTTATCTCCAACACCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006662
VALIDATED
SRCAP MISSION shRNA shRNA Plasmid DNA
Snf2-related CREBBP activator protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006662.2-10127s21c1
Sequence:CCGGGACCAGGCCTGACTCTGTTAACTCGAGTTAACAGAGTCAGGCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006662.2-6683s21c1
Sequence:CCGGGCCTTGATGGAACGGTTCAATCTCGAGATTGAACCGTTCCATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006662.2-1504s21c1
Sequence:CCGGCCCTCAGGTGTTGGAGATAAACTCGAGTTTATCTCCAACACCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006662.2-7085s21c1
Sequence:CCGGGCCAGCAAGCAGACTCATATTCTCGAGAATATGAGTCTGCTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006662.2-6499s21c1
Sequence:CCGGCCAGTATGATTGCGGAAAGTTCTCGAGAACTTTCCGCAATCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-2437s1c1
Sequence:CCGGCGGATAGACATGGGTCGATTTCTCGAGAAATCGACCCATGTCTATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-5547s1c1
Sequence:CCGGCCAGTATGATTGCGGAAAGTTCTCGAGAACTTTCCGCAATCATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-6133s1c1
Sequence:CCGGGCCAGCAAGCAGACTCATATTCTCGAGAATATGAGTCTGCTTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-5731s1c1
Sequence:CCGGGCCTTGATGGAACGGTTCAATCTCGAGATTGAACCGTTCCATCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-738s1c1
Sequence:CCGGCCCTCAGGTGTTGGAGATAAACTCGAGTTTATCTCCAACACCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006662
VALIDATED
SRCAP MISSION shRNA Lentiviral Transduction Particles
Snf2-related CREBBP activator protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006662.2-10127s21c1
Sequence:CCGGGACCAGGCCTGACTCTGTTAACTCGAGTTAACAGAGTCAGGCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006662.2-6683s21c1
Sequence:CCGGGCCTTGATGGAACGGTTCAATCTCGAGATTGAACCGTTCCATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006662.2-1504s21c1
Sequence:CCGGCCCTCAGGTGTTGGAGATAAACTCGAGTTTATCTCCAACACCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006662.2-7085s21c1
Sequence:CCGGGCCAGCAAGCAGACTCATATTCTCGAGAATATGAGTCTGCTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006662.2-6499s21c1
Sequence:CCGGCCAGTATGATTGCGGAAAGTTCTCGAGAACTTTCCGCAATCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-2437s1c1
Sequence:CCGGCGGATAGACATGGGTCGATTTCTCGAGAAATCGACCCATGTCTATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-5547s1c1
Sequence:CCGGCCAGTATGATTGCGGAAAGTTCTCGAGAACTTTCCGCAATCATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-6133s1c1
Sequence:CCGGGCCAGCAAGCAGACTCATATTCTCGAGAATATGAGTCTGCTTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-5731s1c1
Sequence:CCGGGCCTTGATGGAACGGTTCAATCTCGAGATTGAACCGTTCCATCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006662.1-738s1c1
Sequence:CCGGCCCTCAGGTGTTGGAGATAAACTCGAGTTTATCTCCAACACCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks